ligD

168

sensitivity to ionizing radiation in the stationary phase  PubMed

sensitivity of spores to several DNA-damaging treatments known to cause double strand breaks, such as UV-ray, X-ray, ultrahigh vacuum and wet heat PubMed

a ''ykoV-ligD'' double mutant is sensitive to radiation PubMed

reduced resistance towards electron beams PubMed

has inherent polymerization and ligase activities that allow it to fill the short gaps that can arise after realignment of the broken ends and to seal the resulting nicks, contributing to genome stability during the stationary phase and germination

has an intrinsic 5'-2-deoxyribose-5-phosphate (dRP) lyase activity located at the N-terminal ligase domain PubMed

ATP + (deoxyribonucleotide)(n)-3'-hydroxyl + 5'-phospho-(deoxyribonucleotide)(m) --> (deoxyribonucleotide)(n+m) + AMP + diphosphate (according to UniProt)

N-terminal part: LigD polymerase family (single member, according to UniProt)

C-terminal part: ATP-dependent DNA ligase family (with LigB, according to UniProt)

N-terminal DNA ligase catalytic domain (aa 1 - 331) linked to a C-terminal polymerase domain (aa 332 - 611) PubMed

6NHX (PDB) (N-terminal ligase domain, from Mycobacterium tuberculosis, 26.3% identity) PubMed

5OP0 (PDB) (C-terminal polymerase domain, from Mycobacterium smegmatis, 30% identity) PubMed

MGNA-A778 (ykoU::erm), available at the NBRP B. subtilis, Japan

BP141 (Δ''ykoV-ligD::kan'') available in Fabian Commichau's and Jörg Stülke's labs PubMed

BP142 (Δ''dgcW-ykoV-ligD::kan'') available in Fabian Commichau's lab

BKE13400 (ΔligD::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CGGCTGCATGGTAAACGCCA,  downstream forward: _UP4_TGACTAATGAAGTCAGCTCT

BKK13400 (ΔligD::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CGGCTGCATGGTAAACGCCA,  downstream forward: _UP4_TGACTAATGAAGTCAGCTCT