zur
168

transcriptional repressor, regulates zinc homeostasis

Locus

BSU_25100

Molecular weight

16.42 kDa

Isoelectric point

4.86

Protein length

145 aaSequenceBlast

Gene length

438 bpSequenceBlast

Function

regulation of zinc homeostasis(zagA, znuA-znuC-znuB)

Product

transcriptional repressor (Fur family)

Essential

Synonyms

zur, yqfV

Outlinks

BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Homeostasis, Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo), Zinc

Information processing, Regulation of gene expression, Transcription factors and their control, Transcription factors/ other

Groups of genes, Phosphoproteins, Phosphorylation on either a Ser, Thr or Tyr residue

List of homologs in different organisms, belongs to COG0735 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene

Coordinates

2,591,428 2,591,865

The protein

Protein family

Fur family (according to UniProt)

Structure

2FE3 (PDB) (PerR, 35% identity) PubMed

P54479 (AlphaFold)

Modification

phosphorylated on ser/ thr/ tyr PubMed

Effectors of protein activity

sequential binding of zinc (two atoms per monomer) results in the activation of Zur dimer and thus in repression of the genes of the Zur regulon PubMed

zinc binding is negatively co-operative resulting in step-wise induction of the genes of the Zur regulon upon zinc depletion PubMed

Paralogous protein(s)

Fur, PerR

Localization

information on binding sites can be found in the PRODORIC2 database

Expression and Regulation

Operons

Genes

yqfU-zur

Description

PubMed

Open in new tab

Biological materials

Mutant

1A904 ( zur::spec), PubMed, available at BGSC

BKE25100 (zur::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGAAGGGTCCCCCTTTTC, downstream forward: _UP4_TAAAATGCGTATATATGAAA

BKK25100 (zur::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGAAGGGTCCCCCTTTTC, downstream forward: _UP4_TAAAATGCGTATATATGAAA

Labs working on this gene/protein

John Helmann, Cornell University, USA Homepage

References

Reviews

Capdevila DA, Rondón JJ, Edmonds KA, Rocchio JS, Dujovne MV, Giedroc DPBacterial Metallostasis: Metal Sensing, Metalloproteome Remodeling, and Metal Trafficking.Chemical reviews. 2024 Dec 10; . PMID: 39658019

Original Publications

Randazzo P, Anba-Mondoloni J, Aubert-Frambourg A, Guillot A, Pechoux C, Vidic J, Auger S regulators MntR and Zur participate in redox cycling, antibiotic sensitivity, and cell wall plasticity. Journal of bacteriology. 2019 Dec 09; . pii:JB.00547-19. doi:10.1128/JB.00547-19. PMID:31818924

Shin JH, Helmann JD Molecular logic of the Zur-regulated zinc deprivation response in Bacillus subtilis. Nature communications. 2016 Aug 26; 7:12612. doi:10.1038/ncomms12612. PMID:27561249

Prestel E, Noirot P, Auger S Genome-wide identification of Bacillus subtilis Zur-binding sites associated with a Zur box expands its known regulatory network. BMC microbiology. 2015 Feb 04; 15:13. doi:10.1186/s12866-015-0345-4. PMID:25649915

Ma Z, Gabriel SE, Helmann JD Sequential binding and sensing of Zn(II) by Bacillus subtilis Zur. Nucleic acids research. 2011 Nov; 39(21):9130-8. doi:10.1093/nar/gkr625. PMID:21821657

Gabriel SE, Helmann JD Contributions of Zur-controlled ribosomal proteins to growth under zinc starvation conditions. Journal of bacteriology. 2009 Oct; 191(19):6116-22. doi:10.1128/JB.00802-09. PMID:19648245

Gabriel SE, Miyagi F, Gaballa A, Helmann JD Regulation of the Bacillus subtilis yciC gene and insights into the DNA-binding specificity of the zinc-sensing metalloregulator Zur. Journal of bacteriology. 2008 May; 190(10):3482-8. doi:10.1128/JB.01978-07. PMID:18344368

Traoré DA, El Ghazouani A, Ilango S, Dupuy J, Jacquamet L, Ferrer JL, Caux-Thang C, Duarte V, Latour JM Crystal structure of the apo-PerR-Zn protein from Bacillus subtilis. Molecular microbiology. 2006 Sep; 61(5):1211-9. . PMID:16925555

Lévine A, Vannier F, Absalon C, Kuhn L, Jackson P, Scrivener E, Labas V, Vinh J, Courtney P, Garin J, Séror SJ Analysis of the dynamic Bacillus subtilis Ser/Thr/Tyr phosphoproteome implicated in a wide variety of cellular processes. Proteomics. 2006 Apr; 6(7):2157-73. . PMID:16493705

Fuangthong M, Helmann JD Recognition of DNA by three ferric uptake regulator (Fur) homologs in Bacillus subtilis. Journal of bacteriology. 2003 Nov; 185(21):6348-57. . PMID:14563870

Panina EM, Mironov AA, Gelfand MS Comparative genomics of bacterial zinc regulons: enhanced ion transport, pathogenesis, and rearrangement of ribosomal proteins. Proceedings of the National Academy of Sciences of the United States of America. 2003 Aug 19; 100(17):9912-7. . PMID:12904577

Gaballa A, Wang T, Ye RW, Helmann JD Functional analysis of the Bacillus subtilis Zur regulon. Journal of bacteriology. 2002 Dec; 184(23):6508-14. . PMID:12426338

Gaballa A, Helmann JD Identification of a zinc-specific metalloregulatory protein, Zur, controlling zinc transport operons in Bacillus subtilis. Journal of bacteriology. 1998 Nov; 180(22):5815-21. . PMID:9811636

Page visits: 6246

Time of last update: 2025-04-04 02:03:39

Author of last update: Jstuelk

zur 168

zur
168