ptsH
168

HPr, General component of the sugar phosphotransferase system (PTS)

Locus

BSU_13900

Molecular weight

9.05 kDa

Isoelectric point

4.58

Protein length

88 aaSequenceBlast

Gene length

267 bpSequenceBlast

Function

PTS-dependent sugar transport and carbon catabolite repression

Product

histidine-containing phosphocarrier protein HPr of the PTS

Essential

E.C.

2.7.11.-

Synonyms

ptsH, HPr

Outlinks

BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Cell envelope and cell division, Cell shape

Cellular processes, Transporters, Phosphotransferase system, General PTS proteins

Information processing, Regulation of gene expression, Transcription factors and their control, Control of transcription factor (other than two-component system)

Groups of genes, Phosphoproteins, Phosphorylation on a His residue

Groups of genes, Phosphoproteins, Phosphorylation on a Ser residue

List of homologs in different organisms, belongs to COG1925 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene

Coordinates

1,459,384 1,459,650

Phenotypes of a mutant

the mutant cells are thinner and shorter than wild type cells PubMed

The protein

Protein family

HPr family (with Crh, according to UniProt)

Domains

HPr domain (aa 2-88) (according to UniProt)

Structure

2FEP (PDB) PubMed

2HID (PDB) (NMR) PubMed

1KKM (PDB) (complex of L. casei HprK with B. subtilis HPr-Ser-P)

1KKL (PDB) (complex of Lactobacillus casei HprK with B. subtilis HPr)

3OQM (PDB) (complex of B. subtilis CcpA with P-Ser-HPr and the ackA operator site)

3OQN (PDB) (complex of B. subtilis CcpA with P-Ser-HPr and the gntR operator site)

3OQO (PDB) (complex of B. subtilis CcpA with P-Ser-HPr and a optimal synthetic operator site)

P08877 (AlphaFold)

Modification

transient phosphorylation by Enzyme I of the PTS on His-15

regulatory phosphorylation on Ser-46 by HprK PubMed

an extensive study on in vivo HPr phosphorylation can be found in Singh et al. (2008) PubMed

weak phosphorylation on Ser-12 PubMed

in vitro phosphorylated by PrkC on Ser-12 PubMed

Paralogous protein(s)

Crh

Additional information

belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

Genes

ptsH-ptsI

Description

PubMed

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Open in new tab

Genes

ptsG-ptsH-ptsI

Description

PubMed

Regulation

expression activated by glucose (2 fold) (GlcT) PubMed

Regulatory mechanism

stringent response: negative regulation, in stringent response

GlcT: antitermination, via the GlcT-dependent RNA switch PubMed, in glcT regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Open in new tab

Biological materials

Mutant

available in Jörg Stülke's lab:

MZ303 (cat)

GP507 ptsH1 (S46A)

GP506 (ptsH-H15A)

GP778 (glcT-ptsG-ptsH-ptsI::spc) PubMed

BKE13900 (ptsH::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT

BKK13900 (ptsH::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT

Expression vectors

pGP438 (with N-terminal Strep-tag, in pGP172), available in Jörg Stülke's lab

pAG2 (His-tag) PubMed, available in Anne Galinier lab

pGP371(expression / purification of HPr-S46A, with His-tag from E. coli, in pWH844), available in Jrg Stlke's lab

pGP1415 (HPr, expression in B. subtilis, from pBQ200), available in Jörg Stülke's lab

pGP961 (HPr, expression in B. subtilis with N-terminal Strep-tag, for SPINE, available in Jörg Stülke's lab

pGP1416 (HPr-H15A, expression in B. subtilis, from pBQ200), available in Jörg Stülke's lab

pGP3628 expression of Strep-ptsH by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab

Two-hybrid system

B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

Antibody

available in Jörg Stülke's lab

GFP fusion

GP1267, ptsH-cfp, available in Jörg Stülke's lab PubMed

Labs working on this gene/protein

Jörg Stülke, University of Gttingen, Germany Homepage

Richard Brennan, Houston, Texas, USA Homepage

Anne Galinier, University of Marseille, France

References

Reviews

Deutscher J, Aké FM, Derkaoui M, Zébré AC, Cao TN, Bouraoui H, Kentache T, Mokhtari A, Milohanic E, Joyet P The bacterial phosphoenolpyruvate:carbohydrate phosphotransferase system: regulation by protein phosphorylation and phosphorylation-dependent protein-protein interactions. Microbiology and molecular biology reviews : MMBR. 2014 Jun; 78(2):231-56. doi:10.1128/MMBR.00001-14. PMID:24847021

Görke B, Stülke J Carbon catabolite repression in bacteria: many ways to make the most out of nutrients. Nature reviews. Microbiology. 2008 Aug; 6(8):613-24. doi:10.1038/nrmicro1932. PMID:18628769

Deutscher J, Francke C, Postma PW How phosphotransferase system-related protein phosphorylation regulates carbohydrate metabolism in bacteria. Microbiology and molecular biology reviews : MMBR. 2006 Dec; 70(4):939-1031. . PMID:17158705

Stülke J, Hillen W Regulation of carbon catabolism in Bacillus species. Annual review of microbiology. 2000; 54:849-80. . PMID:11018147

Stülke J, Hillen W Coupling physiology and gene regulation in bacteria: the phosphotransferase sugar uptake system delivers the signals. Die Naturwissenschaften. 1998 Dec; 85(12):583-92. . PMID:9871918

Original Publications

Gómez-Flores AK, López-Pérez E, Alas-Guardado SJMolecular Dynamics Simulations of HPr Proteins from a Thermophilic and a Mesophilic Organism: A Comparative Thermal Study.International journal of molecular sciences. 2023 May 31; 24(11). PMID: 37298508

O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589

Rosenberg A, Soufi B, Ravikumar V, Soares NC, Krug K, Smith Y, Macek B, Ben-Yehuda S Phosphoproteome dynamics mediate revival of bacterial spores. BMC biology. 2015 Sep 17; 13:76. doi:10.1186/s12915-015-0184-7. PMID:26381121

Garcia De Gonzalo CV, Denham EL, Mars RA, Stülke J, van der Donk WA, van Dijl JM The phosphoenolpyruvate:sugar phosphotransferase system is involved in sensitivity to the glucosylated bacteriocin sublancin. Antimicrobial agents and chemotherapy. 2015 Nov; 59(11):6844-54. doi:10.1128/AAC.01519-15. PMID:26282429

Wenzel M, Altenbuchner J The Bacillus subtilis mannose regulator, ManR, a DNA-binding protein regulated by HPr and its cognate PTS transporter ManP. Molecular microbiology. 2013 May; 88(3):562-76. doi:10.1111/mmi.12209. PMID:23551403

Rothe FM, Wrede C, Lehnik-Habrink M, Görke B, Stülke J Dynamic localization of a transcription factor in Bacillus subtilis: the LicT antiterminator relocalizes in response to inducer availability. Journal of bacteriology. 2013 May; 195(10):2146-54. doi:10.1128/JB.00117-13. PMID:23475962

Himmel S, Zschiedrich CP, Becker S, Hsiao HH, Wolff S, Diethmaier C, Urlaub H, Lee D, Griesinger C, Stülke J Determinants of interaction specificity of the Bacillus subtilis GlcT antitermination protein: functionality and phosphorylation specificity depend on the arrangement of the regulatory domains. The Journal of biological chemistry. 2012 Aug 10; 287(33):27731-42. doi:10.1074/jbc.M112.388850. PMID:22722928

Meyer FM, Jules M, Mehne FM, Le Coq D, Landmann JJ, Görke B, Aymerich S, Stülke J Malate-mediated carbon catabolite repression in Bacillus subtilis involves the HPrK/CcpA pathway. Journal of bacteriology. 2011 Dec; 193(24):6939-49. doi:10.1128/JB.06197-11. PMID:22001508

Joyet P, Derkaoui M, Poncet S, Deutscher J Control of Bacillus subtilis mtl operon expression by complex phosphorylation-dependent regulation of the transcriptional activator MtlR. Molecular microbiology. 2010 Jun 01; 76(5):1279-94. doi:10.1111/j.1365-2958.2010.07175.x. PMID:20444094

Pietack N, Becher D, Schmidl SR, Saier MH, Hecker M, Commichau FM, Stülke J In vitro phosphorylation of key metabolic enzymes from Bacillus subtilis: PrkC phosphorylates enzymes from different branches of basic metabolism. Journal of molecular microbiology and biotechnology. 2010; 18(3):129-40. doi:10.1159/000308512. PMID:20389117

Tojo S, Kumamoto K, Hirooka K, Fujita Y Heavy involvement of stringent transcription control depending on the adenine or guanine species of the transcription initiation site in glucose and pyruvate metabolism in Bacillus subtilis. Journal of bacteriology. 2010 Mar; 192(6):1573-85. doi:10.1128/JB.01394-09. PMID:20081037

Poncet S, Soret M, Mervelet P, Deutscher J, Noirot P Transcriptional activator YesS is stimulated by histidine-phosphorylated HPr of the Bacillus subtilis phosphotransferase system. The Journal of biological chemistry. 2009 Oct 09; 284(41):28188-97. doi:10.1074/jbc.M109.046334. PMID:19651770

Singh KD, Schmalisch MH, Stülke J, Görke B Carbon catabolite repression in Bacillus subtilis: quantitative analysis of repression exerted by different carbon sources. Journal of bacteriology. 2008 Nov; 190(21):7275-84. doi:10.1128/JB.00848-08. PMID:18757537

Singh KD, Halbedel S, Görke B, Stülke J Control of the phosphorylation state of the HPr protein of the phosphotransferase system in Bacillus subtilis: implication of the protein phosphatase PrpC. Journal of molecular microbiology and biotechnology. 2007; 13(1-3):165-71. . PMID:17693724

Macek B, Mijakovic I, Olsen JV, Gnad F, Kumar C, Jensen PR, Mann M The serine/threonine/tyrosine phosphoproteome of the model bacterium Bacillus subtilis. Molecular & cellular proteomics : MCP. 2007 Apr; 6(4):697-707. . PMID:17218307

Pompeo F, Luciano J, Galinier A Interaction of GapA with HPr and its homologue, Crh: Novel levels of regulation of a key step of glycolysis in Bacillus subtilis? Journal of bacteriology. 2007 Feb; 189(3):1154-7. . PMID:17142398

Chaptal V, Gueguen-Chaignon V, Poncet S, Lecampion C, Meyer P, Deutscher J, Galinier A, Nessler S, Moréra S Structural analysis of B. subtilis CcpA effector binding site. Proteins. 2006 Aug 15; 64(3):814-6. . PMID:16755587

Müller W, Horstmann N, Hillen W, Sticht H The transcription regulator RbsR represents a novel interaction partner of the phosphoprotein HPr-Ser46-P in Bacillus subtilis. The FEBS journal. 2006 Mar; 273(6):1251-61. . PMID:16519689

Eymann C, Dreisbach A, Albrecht D, Bernhardt J, Becher D, Gentner S, Tam le T, Büttner K, Buurman G, Scharf C, Venz S, Völker U, Hecker M A comprehensive proteome map of growing Bacillus subtilis cells. Proteomics. 2004 Oct; 4(10):2849-76. . PMID:15378759

Schumacher MA, Allen GS, Diel M, Seidel G, Hillen W, Brennan RG Structural basis for allosteric control of the transcription regulator CcpA by the phosphoprotein HPr-Ser46-P. Cell. 2004 Sep 17; 118(6):731-41. . PMID:15369672

Görke B, Fraysse L, Galinier A Drastic differences in Crh and HPr synthesis levels reflect their different impacts on catabolite repression in Bacillus subtilis. Journal of bacteriology. 2004 May; 186(10):2992-5. . PMID:15126459

Schmalisch MH, Bachem S, Stülke J Control of the Bacillus subtilis antiterminator protein GlcT by phosphorylation. Elucidation of the phosphorylation chain leading to inactivation of GlcT. The Journal of biological chemistry. 2003 Dec 19; 278(51):51108-15. . PMID:14527945

Blencke HM, Homuth G, Ludwig H, Mäder U, Hecker M, Stülke J Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways. Metabolic engineering. 2003 Apr; 5(2):133-49. . PMID:12850135

Fieulaine S, Morera S, Poncet S, Mijakovic I, Galinier A, Janin J, Deutscher J, Nessler S X-ray structure of a bifunctional protein kinase in complex with its protein substrate HPr. Proceedings of the National Academy of Sciences of the United States of America. 2002 Oct 15; 99(21):13437-41. . PMID:12359875

Lindner C, Hecker M, Le Coq D, Deutscher J Bacillus subtilis mutant LicT antiterminators exhibiting enzyme I- and HPr-independent antitermination affect catabolite repression of the bglPH operon. Journal of bacteriology. 2002 Sep; 184(17):4819-28. . PMID:12169607

Darbon E, Servant P, Poncet S, Deutscher J Antitermination by GlpP, catabolite repression via CcpA and inducer exclusion triggered by P-GlpK dephosphorylation control Bacillus subtilis glpFK expression. Molecular microbiology. 2002 Feb; 43(4):1039-52. . PMID:11929549

Martin-Verstraete I, Deutscher J, Galinier A Phosphorylation of HPr and Crh by HprK, early steps in the catabolite repression signalling pathway for the Bacillus subtilis levanase operon. Journal of bacteriology. 1999 May; 181(9):2966-9. . PMID:10217795

Lindner C, Galinier A, Hecker M, Deutscher J Regulation of the activity of the Bacillus subtilis antiterminator LicT by multiple PEP-dependent, enzyme I- and HPr-catalysed phosphorylation. Molecular microbiology. 1999 Feb; 31(3):995-1006. . PMID:10048041

Galinier A, Deutscher J, Martin-Verstraete I Phosphorylation of either crh or HPr mediates binding of CcpA to the bacillus subtilis xyn cre and catabolite repression of the xyn operon. Journal of molecular biology. 1999 Feb 19; 286(2):307-14. . PMID:9973552

Martin-Verstraete I, Charrier V, Stülke J, Galinier A, Erni B, Rapoport G, Deutscher J Antagonistic effects of dual PTS-catalysed phosphorylation on the Bacillus subtilis transcriptional activator LevR. Molecular microbiology. 1998 Apr; 28(2):293-303. . PMID:9622354

Jones BE, Rajagopal P, Klevit RE Phosphorylation on histidine is accompanied by localized structural changes in the phosphocarrier protein, HPr from Bacillus subtilis. Protein science : a publication of the Protein Society. 1997 Oct; 6(10):2107-19. . PMID:9336834

Tortosa P, Aymerich S, Lindner C, Saier MH, Reizer J, Le Coq D Multiple phosphorylation of SacY, a Bacillus subtilis transcriptional antiterminator negatively controlled by the phosphotransferase system. The Journal of biological chemistry. 1997 Jul 04; 272(27):17230-7. . PMID:9202047

Charrier V, Buckley E, Parsonage D, Galinier A, Darbon E, Jaquinod M, Forest E, Deutscher J, Claiborne A Cloning and sequencing of two enterococcal glpK genes and regulation of the encoded glycerol kinases by phosphoenolpyruvate-dependent, phosphotransferase system-catalyzed phosphorylation of a single histidyl residue. The Journal of biological chemistry. 1997 May 30; 272(22):14166-74. . PMID:9162046

Pullen K, Rajagopal P, Branchini BR, Huffine ME, Reizer J, Saier MH, Scholtz JM, Klevit RE Phosphorylation of serine-46 in HPr, a key regulatory protein in bacteria, results in stabilization of its solution structure. Protein science : a publication of the Protein Society. 1995 Dec; 4(12):2478-86. . PMID:8580838

Chen Y, Reizer J, Saier MH, Fairbrother WJ, Wright PE Mapping of the binding interfaces of the proteins of the bacterial phosphotransferase system, HPr and IIAglc. Biochemistry. 1993 Jan 12; 32(1):32-7. . PMID:8418852

Frisby D, Zuber P Mutations in pts cause catabolite-resistant sporulation and altered regulation of spo0H in Bacillus subtilis. Journal of bacteriology. 1994 May; 176(9):2587-95. . PMID:8169206

Rajagopal P, Waygood EB, Klevit RE Structural consequences of histidine phosphorylation: NMR characterization of the phosphohistidine form of histidine-containing protein from Bacillus subtilis and Escherichia coli. Biochemistry. 1994 Dec 27; 33(51):15271-82. . PMID:7803390

Deutscher J, Küster E, Bergstedt U, Charrier V, Hillen W Protein kinase-dependent HPr/CcpA interaction links glycolytic activity to carbon catabolite repression in gram-positive bacteria. Molecular microbiology. 1995 Mar; 15(6):1049-53. . PMID:7623661

Stülke J, Martin-Verstraete I, Charrier V, Klier A, Deutscher J, Rapoport G The HPr protein of the phosphotransferase system links induction and catabolite repression of the Bacillus subtilis levanase operon. Journal of bacteriology. 1995 Dec; 177(23):6928-36. . PMID:7592487

Eisermann R, Deutscher J, Gonzy-Treboul G, Hengstenberg W Site-directed mutagenesis with the ptsH gene of Bacillus subtilis. Isolation and characterization of heat-stable proteins altered at the ATP-dependent regulatory phosphorylation site. The Journal of biological chemistry. 1988 Nov 15; 263(32):17050-4. . PMID:2846556

Reizer J, Sutrina SL, Saier MH, Stewart GC, Peterkofsky A, Reddy P Mechanistic and physiological consequences of HPr(ser) phosphorylation on the activities of the phosphoenolpyruvate:sugar phosphotransferase system in gram-positive bacteria: studies with site-specific mutants of HPr. The EMBO journal. 1989 Jul; 8(7):2111-20. . PMID:2507315

Arnaud M, Vary P, Zagorec M, Klier A, Debarbouille M, Postma P, Rapoport G Regulation of the sacPA operon of Bacillus subtilis: identification of phosphotransferase system components involved in SacT activity. Journal of bacteriology. 1992 May; 174(10):3161-70. . PMID:1577686

Herzberg O, Reddy P, Sutrina S, Saier MH, Reizer J, Kapadia G Structure of the histidine-containing phosphocarrier protein HPr from Bacillus subtilis at 2.0-A resolution. Proceedings of the National Academy of Sciences of the United States of America. 1992 Mar 15; 89(6):2499-503. . PMID:1549615

Wittekind M, Rajagopal P, Branchini BR, Reizer J, Saier MH, Klevit RE Solution structure of the phosphocarrier protein HPr from Bacillus subtilis by two-dimensional NMR spectroscopy. Protein science : a publication of the Protein Society. 1992 Oct; 1(10):1363-76. . PMID:1303754

Page visits: 15854

Time of last update: 2025-04-16 00:31:28

Author of last update: Jstuelk

ptsH 168

ptsH
168