fliJ

fliJ
168

flagellar protein required for formation of basal body, part of the ATPase complex, regulator of the FliI ATPase

Locus
BSU_16250
Molecular weight
17.77 kDa
Isoelectric point
8.41
Protein length
147 aaSequenceBlast
Gene length
444 bpSequenceBlast
Function
movement and chemotaxis
Product
flagellar protein required for formation of basal body
Essential
no
Synonyms
fliJ, cheF
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2882 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,697,196  1,697,639
Phenotypes of a mutant
defective in Swarming motility PubMed
The protein
Protein family
FliJ family (single member, according to UniProt)
Structure
3AJW (PDB) (from S. typhimurium, 19% identity, 63% similarity) PubMed
P20487 (AlphaFold)
Localization
cytoplasm, as part of the flagellum attached to the membrane PubMed
Expression and Regulation
Operons
Genes
flgB-flgC-fliE-fliF-fliG-fliH-fliI-fliJ-ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliO-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB
Description
PubMed
Regulation
expression during spore germination is strongly reduced under conditions of osmotic stress PubMed
Regulatory mechanism
Spo0A: repression, in spo0A regulon
SwrA: activation, in swrA regulon
CodY: repression, in codY regulon
DegU: repression, in degU regulon
SinR: transcription elongation, binding of the SinR-SlrR heteromer to sites within fliE and fliI results in inhibition of transcription elongation PubMed, in sinR regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
SigD: sigma factor, PubMed, in sigD regulon
Open in new tab

flgB→swrB

2025-04-03 01:56:48

Jstuelk

173

024d59ae468aa14568753f57122b789c39ed6c06

4D920B925DA071AE7390E022B9AB625E40B7B2AC

Biological materials
Mutant
BKE16250 (fliJ::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACGTTTATTCCTCATTTCC,  downstream forward: _UP4_CAAGGCCATTAGGAGCGAAT
BKK16250 (fliJ::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACGTTTATTCCTCATTTCC,  downstream forward: _UP4_CAAGGCCATTAGGAGCGAAT
References
Reviews
Altegoer F, Bange G Undiscovered regions on the molecular landscape of flagellar assembly. Current opinion in microbiology. 2015 Dec; 28:98-105. doi:10.1016/j.mib.2015.08.011. pii:S1369-5274(15)00138-1. PMID:26490009
Minamino T Protein export through the bacterial flagellar type III export pathway. Biochimica et biophysica acta. 2014 Aug; 1843(8):1642-8. doi:10.1016/j.bbamcr.2013.09.005. pii:S0167-4889(13)00327-3. PMID:24064315
Minamino T, Imada K, Namba K Mechanisms of type III protein export for bacterial flagellar assembly. Molecular bioSystems. 2008 Nov; 4(11):1105-15. doi:10.1039/b808065h. PMID:18931786
Original Publications
Sanchez S, Snider EV, Wang X, Kearns DBIdentification of Genes Required for Swarming Motility in Bacillus subtilis Using Transposon Mutagenesis and High-Throughput Sequencing (TnSeq).Journal of bacteriology. 2022 Jun 21; 204(6):e0008922. PMID: 35638827
Nagler K, Krawczyk AO, De Jong A, Madela K, Hoffmann T, Laue M, Kuipers OP, Bremer E, Moeller R Identification of Differentially Expressed Genes during Bacillus subtilis Spore Outgrowth in High-Salinity Environments Using RNA Sequencing. Frontiers in microbiology. 2016; 7:1564. . PMID:27766092
Mordini S, Osera C, Marini S, Scavone F, Bellazzi R, Galizzi A, Calvio C The role of SwrA, DegU and P(D3) in fla/che expression in B. subtilis. PloS one. 2013; 8(12):e85065. doi:10.1371/journal.pone.0085065. PMID:24386445
Ibuki T, Imada K, Minamino T, Kato T, Miyata T, Namba K Common architecture of the flagellar type III protein export apparatus and F- and V-type ATPases. Nature structural & molecular biology. 2011 Mar; 18(3):277-82. doi:10.1038/nsmb.1977. PMID:21278755
Bange G, Kümmerer N, Engel C, Bozkurt G, Wild K, Sinning I FlhA provides the adaptor for coordinated delivery of late flagella building blocks to the type III secretion system. Proceedings of the National Academy of Sciences of the United States of America. 2010 Jun 22; 107(25):11295-300. doi:10.1073/pnas.1001383107. PMID:20534509
Kobayashi K Gradual activation of the response regulator DegU controls serial expression of genes for flagellum formation and biofilm formation in Bacillus subtilis. Molecular microbiology. 2007 Oct; 66(2):395-409. . PMID:17850253
Werhane H, Lopez P, Mendel M, Zimmer M, Ordal GW, Márquez-Magaña LM The last gene of the fla/che operon in Bacillus subtilis, ylxL, is required for maximal sigmaD function. Journal of bacteriology. 2004 Jun; 186(12):4025-9. . PMID:15175317
Molle V, Fujita M, Jensen ST, Eichenberger P, González-Pastor JE, Liu JS, Losick R The Spo0A regulon of Bacillus subtilis. Molecular microbiology. 2003 Dec; 50(5):1683-701. . PMID:14651647
Estacio W, Anna-Arriola SS, Adedipe M, Márquez-Magaña LM Dual promoters are responsible for transcription initiation of the fla/che operon in Bacillus subtilis. Journal of bacteriology. 1998 Jul; 180(14):3548-55. . PMID:9657996
Márquez-Magaña LM, Chamberlin MJ Characterization of the sigD transcription unit of Bacillus subtilis. Journal of bacteriology. 1994 Apr; 176(8):2427-34. . PMID:8157612
Ying CW, Ordal GW Nucleotide sequence and expression of cheF, an essential gene for chemotaxis in Bacillus subtilis. Journal of bacteriology. 1989 Mar; 171(3):1631-7. . PMID:2493450
Ying CW, Scoffone F, Albertini AM, Galizzi A, Ordal GW Properties of the Bacillus subtilis chemotaxis protein CheF, a homolog of the Salmonella typhimurium flagellar protein FliJ. Journal of bacteriology. 1991 Jun; 173(11):3584-6. . PMID:1904439

600DECF2BE9ADCAB87E53790CE4F0D61F8B3F7CC

Page visits: 3440

Time of last update: 2025-04-13 07:41:45

Author of last update: Jstuelk