pel
168

pectate lyase C

Locus

BSU_07560

Molecular weight

45.34 kDa

Isoelectric point

8.42

Protein length

420 aaSequenceBlast

Gene length

1263 bpSequenceBlast

Function

degradation of polygalacturonic acid

Product

pectate lyase C

Essential

E.C.

4.2.2.2

Synonyms

pel

Outlinks

BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3866 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene

Coordinates

827,993 829,255

The protein

Catalyzed reaction/ biological activity

Eliminative cleavage of (14)-alpha-D-galacturonan to give oligosaccharides with 4-deoxy-alpha-D-galact-4-enuronosyl groups at their non-reducing ends (according to UniProt)

Protein family

lyase 1 family (according to UniProt)

Structure

2O1D (PDB) (bound to trisaccharide), 1BN8 (PDB), 5X2I (PDB)

P39116 (AlphaFold)

Localization

extracellular (signal peptide), major constituent of the secretome PubMed

Expression and Regulation

Operons

Genes

pel

Description

PubMed

Regulation

expressed at high cell density (ComA) PubMed

Regulatory mechanism

CcpA: repression, in ccpA regulon

TnrA: repression, PubMed, in tnrA regulon

ComA: activation, (ComA) PubMed, in comA regulon

Open in new tab

Biological materials

Mutant

MGNA-C248 (pel::erm), available at the NBRP B. subtilis, Japan

BKE07560 (pel::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCCACTATGTACCCCCAT, downstream forward: _UP4_TAAGAAAGTGAAAAACACAA

BKK07560 (pel::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCCACTATGTACCCCCAT, downstream forward: _UP4_TAAGAAAGTGAAAAACACAA

References

Reviews

Marvasi M, Visscher PT, Casillas Martinez L Exopolymeric substances (EPS) from Bacillus subtilis: polymers and genes encoding their synthesis. FEMS microbiology letters. 2010 Dec; 313(1):1-9. doi:10.1111/j.1574-6968.2010.02085.x. PMID:20735481

Original Publications

Wu K, Wu J, Li X, Yang T, Chen X, Yang XComparative transcriptome analysis of wild type and a pectate lyase mutant strain of Bacillus subtilis.The new microbiologica. 2023 Feb; 46(1):52-55. PMID: 36853818

Reuß DR, Altenbuchner J, Mäder U, Rath H, Ischebeck T, Sappa PK, Thürmer A, Guérin C, Nicolas P, Steil L, Zhu B, Feussner I, Klumpp S, Daniel R, Commichau FM, Völker U, Stülke J Large-scale reduction of the Bacillus subtilis genome: consequences for the transcriptional network, resource allocation, and metabolism. Genome research. 2017 Feb; 27(2):289-299. doi:10.1101/gr.215293.116. PMID:27965289

Ma G, Zhu W, Liu Y QM/MM studies on the calcium-assisted β-elimination mechanism of pectate lyase from bacillus subtilis. Proteins. 2016 Nov; 84(11):1606-1615. doi:10.1002/prot.25103. PMID:27447541

Wolf D, Rippa V, Mobarec JC, Sauer P, Adlung L, Kolb P, Bischofs IB The quorum-sensing regulator ComA from Bacillus subtilis activates transcription using topologically distinct DNA motifs. Nucleic acids research. 2016 Mar 18; 44(5):2160-72. doi:10.1093/nar/gkv1242. PMID:26582911

Mirouze N, Bidnenko E, Noirot P, Auger S Genome-wide mapping of TnrA-binding sites provides new insights into the TnrA regulon in Bacillus subtilis. MicrobiologyOpen. 2015 Jun; 4(3):423-35. doi:10.1002/mbo3.249. PMID:25755103

Voigt B, Antelmann H, Albrecht D, Ehrenreich A, Maurer KH, Evers S, Gottschalk G, van Dijl JM, Schweder T, Hecker M Cell physiology and protein secretion of Bacillus licheniformis compared to Bacillus subtilis. Journal of molecular microbiology and biotechnology. 2009; 16(1-2):53-68. doi:10.1159/000142894. PMID:18957862

Comella N, Grossman AD Conservation of genes and processes controlled by the quorum response in bacteria: characterization of genes controlled by the quorum-sensing transcription factor ComA in Bacillus subtilis. Molecular microbiology. 2005 Aug; 57(4):1159-74. . PMID:16091051

Blencke HM, Homuth G, Ludwig H, Mäder U, Hecker M, Stülke J Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways. Metabolic engineering. 2003 Apr; 5(2):133-49. . PMID:12850135

Yoshida K, Yamaguchi H, Kinehara M, Ohki YH, Nakaura Y, Fujita Y Identification of additional TnrA-regulated genes of Bacillus subtilis associated with a TnrA box. Molecular microbiology. 2003 Jul; 49(1):157-65. . PMID:12823818

Nasser W, Awadé AC, Reverchon S, Robert-Baudouy J Pectate lyase from Bacillus subtilis: molecular characterization of the gene, and properties of the cloned enzyme. FEBS letters. 1993 Dec 13; 335(3):319-26. . PMID:8262178

Pickersgill R, Jenkins J, Harris G, Nasser W, Robert-Baudouy J The structure of Bacillus subtilis pectate lyase in complex with calcium. Nature structural biology. 1994 Oct; 1(10):717-23. . PMID:7634076

Page visits: 3287

Time of last update: 2025-04-15 21:23:49

Author of last update: Jstuelk

pel 168

pel
168