pfeT

pfeT
168

Fe2+ efflux pump, P1B4-type ATPase, protects the cell against iron intoxication

Locus
BSU_13850
Molecular weight
68.39 kDa
Isoelectric point
4.93
Protein length
637 aaSequenceBlast
Gene length
1914 bpSequenceBlast
Function
protection against toxic iron
Product
Fe2+ efflux pump
Essential
no
E.C.
3.6.3.5
Synonyms
pfeT, ykvW, zosA
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

List of homologs in different organisms, belongs to COG2217 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, Fur regulon, PerR regulon

Gene
Coordinates
1,451,371  1,453,284
Phenotypes of a mutant
sensitivity to iron, this can be suppressed by low levels of Mn2+ PubMed
reduced genetic competence, can be rescued by the addition of excess zinc PubMed
reduced expression of comK, control is exerted at the post-transcriptional level and can be rescued by the addition of excess zinc  PubMed
The protein
Catalyzed reaction/ biological activity
ATP + H2O + Zn2+ --> ADP + H+ + phosphate + Zn2+ (according to UniProt)
P-type zinc-transporting ATPase PubMed
Protein family
cation transport ATPase (P-type) (TC 3.A.3) family (according to UniProt)
Structure
4UMV (PDB) (zinc transporter from Shigella sonnei, 39% identity) PubMed
O31688 (AlphaFold)
Paralogous protein(s)
CadA, CopA
Localization
cell membrane (according to UniProt)
Expression and Regulation
Operons
Genes
pfeT
Description
PubMed
Regulation
induced by hydrogen peroxide (AhpC, PerR) PubMed
induced by iron excess (Fur) PubMed
Regulatory mechanism
PerR: repression, PubMed, in perR regulon
Fur: activation, PubMed, in fur regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Additional information
A ncRNA is predicted between 'StoA' and 'PfeT' PubMed
Open in new tab

pfeT

2025-04-03 13:29:55

Jstuelk

124

7395CB3CFEA13FF61E5B9152C9EC4DC858E06CAE

C104F1AB31E42CB2D37EF1444301AA8A2700C4B3

Biological materials
Mutant
MGNA-B329 (ykvW::erm), available at the NBRP B. subtilis, Japan
GP3357 (pfeT::phleo trpC2) available in Jörg Stülke's lab
BKE13850 (pfeT::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATCGAATTCTCCTCTCT,  downstream forward: _UP4_TAAAACCAGCAGCCTAATCA
BKK13850 (pfeT::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATCGAATTCTCCTCTCT,  downstream forward: _UP4_TAAAACCAGCAGCCTAATCA
References
Reviews
Pi H, Helmann JD Ferrous iron efflux systems in bacteria. Metallomics : integrated biometal science. 2017 Jul 19; 9(7):840-851. doi:10.1039/c7mt00112f. PMID:28604884
Original Publications
Steingard CH, Pinochet-Barros A, Wendel BM, Helmann JDIron homeostasis in Bacillus subtilis relies on three differentially expressed efflux systems.Microbiology (Reading, England). 2023 Jan; 169(1). PMID: 36748638
Pinochet-Barros A, Helmann JD Fur is a transcriptional activator for the PerR-repressed gene encoding an iron efflux pump. Journal of bacteriology. 2020 Jan 27; . pii:JB.00697-19. doi:10.1128/JB.00697-19. PMID:31988078
Fukuhara T, Kobayashi K, Kanayama Y, Enomoto S, Kondo T, Tsunekawa N, Nemoto M, Ogasawara N, Inagaki K, Tamura T Identification and characterization of the zosA gene involved in copper uptake in Bacillus subtilis 168. Bioscience, biotechnology, and biochemistry. 2016; 80(3):600-9. doi:10.1080/09168451.2015.1107462. PMID:26566138
Guan G, Pinochet-Barros A, Gaballa A, Patel SJ, Argüello JM, Helmann JD PfeT, a P1B4 -type ATPase, effluxes ferrous iron and protects Bacillus subtilis against iron intoxication. Molecular microbiology. 2015 Nov; 98(4):787-803. doi:10.1111/mmi.13158. PMID:26261021
Wang K, Sitsel O, Meloni G, Autzen HE, Andersson M, Klymchuk T, Nielsen AM, Rees DC, Nissen P, Gourdon P Structure and mechanism of Zn2+-transporting P-type ATPases. Nature. 2014 Oct 23; 514(7523):518-22. doi:10.1038/nature13618. PMID:25132545
Faulkner MJ, Ma Z, Fuangthong M, Helmann JD Derepression of the Bacillus subtilis PerR peroxide stress response leads to iron deficiency. Journal of bacteriology. 2012 Mar; 194(5):1226-35. doi:10.1128/JB.06566-11. PMID:22194458
Ogura M ZnuABC and ZosA zinc transporters are differently involved in competence development in Bacillus subtilis. Journal of biochemistry. 2011 Dec; 150(6):615-25. doi:10.1093/jb/mvr098. PMID:21813502
Irnov I, Sharma CM, Vogel J, Winkler WC Identification of regulatory RNAs in Bacillus subtilis. Nucleic acids research. 2010 Oct; 38(19):6637-51. doi:10.1093/nar/gkq454. PMID:20525796
Fuangthong M, Helmann JD Recognition of DNA by three ferric uptake regulator (Fur) homologs in Bacillus subtilis. Journal of bacteriology. 2003 Nov; 185(21):6348-57. . PMID:14563870
Gaballa A, Helmann JD Bacillus subtilis CPx-type ATPases: characterization of Cd, Zn, Co and Cu efflux systems. Biometals : an international journal on the role of metal ions in biology, biochemistry, and medicine. 2003 Dec; 16(4):497-505. . PMID:12779235
Helmann JD, Wu MF, Gaballa A, Kobel PA, Morshedi MM, Fawcett P, Paddon C The global transcriptional response of Bacillus subtilis to peroxide stress is coordinated by three transcription factors. Journal of bacteriology. 2003 Jan; 185(1):243-53. . PMID:12486061
Gaballa A, Wang T, Ye RW, Helmann JD Functional analysis of the Bacillus subtilis Zur regulon. Journal of bacteriology. 2002 Dec; 184(23):6508-14. . PMID:12426338
Gaballa A, Helmann JD A peroxide-induced zinc uptake system plays an important role in protection against oxidative stress in Bacillus subtilis. Molecular microbiology. 2002 Aug; 45(4):997-1005. . PMID:12180919
Gaballa A, Helmann JD A peroxide-induced zinc uptake system plays an important role in protection against oxidative stress in Bacillus subtilis. Molecular microbiology. 2002 Aug; 45(4):997-1005. . PMID:12180919
Gaballa A, Helmann JD A peroxide-induced zinc uptake system plays an important role in protection against oxidative stress in Bacillus subtilis. Molecular microbiology. 2002 Aug; 45(4):997-1005. . PMID:12180919

017A57F27DD8E515242FB658A61E74C1D58273CC

Page visits: 4869

Time of last update: 2025-04-06 22:49:45

Author of last update: LorenzDemann