cdaA

cdaA
168

diadenylate cyclase, synthesis of c-di-AMP in vegetative cells

Locus
BSU_01750
Molecular weight
30.42 kDa
Isoelectric point
8.07
Protein length
273 aaSequenceBlast
Gene length
822 bpSequenceBlast
Function
synthesis of c-di-AMP
Product
diadenylate cyclase
Essential
no
E.C.
2.7.7.85
Synonyms
cdaA, ybbP, ybbQ
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1624 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
196,213 → 197,034
Phenotypes of a mutant
inactivation of ''cdaA'' results in severe beta-lactam sensitivity PubMed
a cdaA disA double mutant or cdaA cdaS disA triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) PubMed
increased spontaneous mutagenesis PubMed
The protein
Catalyzed reaction/ biological activity
synthesis of c-di-AMP from two molecules of ATP PubMed
2 ATP --> c-di-AMP + 2 diphosphate (according to UniProt)
Protein family
adenylate cyclase family (with CdaS, according to UniProt)
Domains
contains a DAC domain involved in the synthesis of c-di-AMP PubMed
DAC domain (aa 82-242) (according to UniProt)
Cofactors
Mn2+ PubMed
Structure
8OGM (PDB) (the DAC domain) PubMed
7OLH (PDB), 7OJS (PDB) (complex of the CdaA DAC domain and GlmM)
4RV7 (PDB) (the DAC domain and C-terminal domain of CdaA from Listeria monocytogenes (aa 101 - 273), 65% identity) PubMed
6HVL (PDB) (the DAC domain and C-terminal domain of CdaA from Listeria monocytogenes (aa 101 - 273) in complex with c-di-AMP, 65% identity) PubMed
Q45589 (AlphaFold)
Effectors of protein activity
the interaction with CdaR controls the diadenylate cyclase activity of CdaA PubMed
the interaction with CdaR inhibits the diadenylate cyclase activity of CdaA (shown in S. aureus) PubMed
the interaction with GlmM inhibits the diadenylate cyclase activity of CdaA (PubMed) under conditions of osmotic stress (shown in L. monocytogenes) PubMed
Paralogous protein(s)
CdaS
Localization
cell membrane PubMed
Expression and Regulation
Operons
Genes
cdaA-cdaR-glmM-glmS
Description
PubMed
Regulatory mechanism
GlmS ribozyme: RNA switch, in GlmS ribozyme
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Open in new tab

cdaA→glmS

2025-03-28 05:21:56

Jstuelk

149

d0e388855d436414f58a0fe3c7427dc65a267c07

DAD2D234926A5513FEB7883AAB4D651657324B25

Additional information
CdaA levels are increased at increased potassium concentrations PubMed
the mRNA is very stable (> 15 min) PubMed
Biological materials
Mutant
GP94 ΔcdaA::spec, available in Jörg Stülke's lab PubMed
GP997 ΔcdaA::cat, available in Jörg Stülke's lab PubMed
GP2790 ΔcdaA::aphA3, available in Jörg Stülke's lab
GP985 ΔcdaA-cdaR::cat, available in Jörg Stülke's lab PubMed
GP2222 cdaA::cat cdaS::ermC ''disA::tet'', available in Jörg Stülke's lab, the mutant is only viable on minimal medium at low potassium concentration PubMed
BKE01750 (ΔcdaA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA,  downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA
BKK01750 (ΔcdaA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA,  downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA
Expression vectors
expression of native cdaA in B. subtilis: pGP1960 (in pBQ200), available in Jörg Stülke's lab
expression of cdaA-Strep in B. subtilis suitable for SPINE: pGP1986 (in pGP382), available in Jörg Stülke's lab
IPTG inducible expression of cdaA-Strep in E. coli: pGP2564 (in pGP574), available in Jörg Stülke's lab
IPTG inducible expression of His-cdaA in E. coli: pGP1970 (in pET19B), available in Jörg Stülke's lab PubMed
Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab. Respective plasmid: pGP1990 PubMed
FLAG-tag construct
GP1381 cdaA-3xFLAG ermC (based on pGP1087), available in Jörg Stülke's lab PubMed
LacZ fusion
GP1339 (cat) based on pAC6, available in Jörg Stülke's lab PubMed
Labs working on this gene/protein
Jörg Stülke, University of Göttingen, Germany Homepage
References
Reviews
Pedraza-Reyes M, Abundiz-Yañez K, Rangel-Mendoza A, Martínez LE, Barajas-Ornelas RC, Cuéllar-Cruz M, Leyva-Sánchez HC, Ayala-García VM, Valenzuela-García LI, Robleto EABacillus subtilis stress-associated mutagenesis and developmental DNA repair.Microbiology and molecular biology reviews : MMBR. 2024 Mar 29; :e0015823. PMID: 38551349
Herzberg C, Meißner J, Warneke R, Stülke JThe many roles of cyclic di-AMP to control the physiology of Bacillus subtilis.microLife. 2023; 4:uqad043. PMID: 37954098
Galperin MYAll DACs in a Row: Domain Architectures of Bacterial and Archaeal Diadenylate Cyclases.Journal of bacteriology. 2023 Apr 25; 205(4):e0002323. PMID: 37022175
Stülke J, Krüger LCyclic di-AMP Signaling in Bacteria.Annual review of microbiology. 2020 Sep 8; 74:159-179. PMID: 32603625
Yin W, Cai X, Ma H, Zhu L, Zhang Y, Chou SH, Galperin MY, He JA decade of research on the second messenger c-di-AMP.FEMS microbiology reviews. 2020 May 30; . PMID: 32472931
Commichau FM, Heidemann JL, Ficner R, Stülke J Making and breaking of an essential poison: the cyclases and phosphodiesterases that produce and degrade the essential second messenger cyclic di-AMP in bacteria. Journal of bacteriology. 2018 Sep 17; . pii:JB.00462-18. doi:10.1128/JB.00462-18. PMID:30224435
Commichau FM, Dickmanns A, Gundlach J, Ficner R, Stülke J A jack of all trades: the multiple roles of the unique essential second messenger cyclic di-AMP. Molecular microbiology. 2015 Jul; 97(2):189-204. doi:10.1111/mmi.13026. PMID:25869574
Corrigan RM, Gründling A Cyclic di-AMP: another second messenger enters the fray. Nature reviews. Microbiology. 2013 Aug; 11(8):513-24. doi:10.1038/nrmicro3069. PMID:23812326
Römling U Great times for small molecules: c-di-AMP, a second messenger candidate in Bacteria and Archaea. Science signaling. 2008 Aug 19; 1(33):pe39. doi:10.1126/scisignal.133pe39. PMID:18714086
Original Publications
Foster AJ, Li H, Drougkas P, Schuurman-Wolters GK, Ten Kate J, Paulino C, Poolman BMembrane-embedded CdaA is required for efficient synthesis of second messenger cyclic di-AMP.Communications biology. 2024 Dec 30; 7(1):1710. PMID: 39739009
Garbers T, Neumann P, Wollenhaupt J, Dickmanns A, Weiss MS, Ficner RCrystallographic fragment screen of the c-di-AMP-synthesizing enzyme CdaA from Bacillus subtilis.Acta crystallographica. Section F, Structural biology communications. 2024 Sep 1; . PMID: 39177700
Abundiz-Yañez K, Leyva-Sánchez HC, Robleto EA, Pedraza-Reyes MStress-Associated and Growth-Dependent Mutagenesis Are Divergently Regulated by c-di-AMP Levels in Bacillus subtilis.International journal of molecular sciences. 2022 Dec 27; 24(1). PMID: 36613897
Pathania M, Tosi T, Millership C, Hoshiga F, Morgan RML, Freemont PS, Gründling AStructural basis for the inhibition of the Bacillus subtilis c-di-AMP cyclase CdaA by the phosphoglucomutase GlmM.The Journal of biological chemistry. 2021 Oct 19; :101317. PMID: 34678313
Gibhardt J, Heidemann JL, Bremenkamp R, Rosenberg J, Seifert R, Kaever V, Ficner R, Commichau FM An extracytoplasmic protein and a moonlighting enzyme modulate synthesis of c-di-AMP in Listeria monocytogenes. Environmental microbiology. 2020 Apr 06; . doi:10.1111/1462-2920.15008. PMID:32250026
Heidemann JL, Neumann P, Dickmanns A, Ficner R Crystal structures of the c-di-AMP synthesizing enzyme CdaA. The Journal of biological chemistry. 2019 May 22; . pii:jbc.RA119.009246. doi:10.1074/jbc.RA119.009246. PMID:31118276
Tosi T, Hoshiga F, Millership C, Singh R, Eldrid C, Patin D, Mengin-Lecreulx D, Thalassinos K, Freemont P, Gründling A Inhibition of the Staphylococcus aureus c-di-AMP cyclase DacA by direct interaction with the phosphoglucosamine mutase GlmM. PLoS pathogens. 2019 Jan 22; 15(1):e1007537. doi:10.1371/journal.ppat.1007537. PMID:30668586
Gundlach J, Herzberg C, Kaever V, Gunka K, Hoffmann T, Weiß M, Gibhardt J, Thürmer A, Hertel D, Daniel R, Bremer E, Commichau FM, Stülke J Control of potassium homeostasis is an essential function of the second messenger cyclic di-AMP in Bacillus subtilis. Science signaling. 2017 Apr 18; 10(475). pii:eaal3011. doi:10.1126/scisignal.aal3011. PMID:28420751
Zhu Y, Pham TH, Nhiep TH, Vu NM, Marcellin E, Chakrabortti A, Wang Y, Waanders J, Lo R, Huston WM, Bansal N, Nielsen LK, Liang ZX, Turner MS Cyclic-di-AMP synthesis by the diadenylate cyclase CdaA is modulated by the peptidoglycan biosynthesis enzyme GlmM in Lactococcus lactis. Molecular microbiology. 2016 Mar; 99(6):1015-27. doi:10.1111/mmi.13281. PMID:26585449
Rismondo J, Gibhardt J, Rosenberg J, Kaever V, Halbedel S, Commichau FM Phenotypes Associated with the Essential Diadenylate Cyclase CdaA and Its Potential Regulator CdaR in the Human Pathogen Listeria monocytogenes. Journal of bacteriology. 2015 Nov 02; 198(3):416-26. doi:10.1128/JB.00845-15. PMID:26527648
Gundlach J, Mehne FM, Herzberg C, Kampf J, Valerius O, Kaever V, Stülke J An Essential Poison: Synthesis and Degradation of Cyclic Di-AMP in Bacillus subtilis. Journal of bacteriology. 2015 Oct; 197(20):3265-74. doi:10.1128/JB.00564-15. PMID:26240071
Gándara C, Alonso JC DisA and c-di-AMP act at the intersection between DNA-damage response and stress homeostasis in exponentially growing Bacillus subtilis cells. DNA repair. 2015 Mar; 27:1-8. doi:10.1016/j.dnarep.2014.12.007. pii:S1568-7864(14)00298-5. PMID:25616256
Rosenberg J, Dickmanns A, Neumann P, Gunka K, Arens J, Kaever V, Stülke J, Ficner R, Commichau FM Structural and biochemical analysis of the essential diadenylate cyclase CdaA from Listeria monocytogenes. The Journal of biological chemistry. 2015 Mar 06; 290(10):6596-606. doi:10.1074/jbc.M114.630418. PMID:25605729
Mehne FM, Gunka K, Eilers H, Herzberg C, Kaever V, Stülke J Cyclic di-AMP homeostasis in bacillus subtilis: both lack and high level accumulation of the nucleotide are detrimental for cell growth. The Journal of biological chemistry. 2013 Jan 18; 288(3):2004-17. doi:10.1074/jbc.M112.395491. PMID:23192352
Luo Y, Helmann JD Analysis of the role of Bacillus subtilis σ(M) in β-lactam resistance reveals an essential role for c-di-AMP in peptidoglycan homeostasis. Molecular microbiology. 2012 Feb; 83(3):623-39. doi:10.1111/j.1365-2958.2011.07953.x. PMID:22211522
Oppenheimer-Shaanan Y, Wexselblatt E, Katzhendler J, Yavin E, Ben-Yehuda S c-di-AMP reports DNA integrity during sporulation in Bacillus subtilis. EMBO reports. 2011 Jun; 12(6):594-601. doi:10.1038/embor.2011.77. PMID:21566650
Hambraeus G, von Wachenfeldt C, Hederstedt L Genome-wide survey of mRNA half-lives in Bacillus subtilis identifies extremely stable mRNAs. Molecular genetics and genomics : MGG. 2003 Aug; 269(5):706-14. . PMID:12884008

AFE2A9998219162FE32E95628B3CA9071099B61A

Page visits: 8301

Time of last update: 2025-04-07 00:12:06

Author of last update: Jstuelk