pycA

pycA
168

pyruvate carboxylase

Locus
BSU_14860
Molecular weight
127.72 kDa
Isoelectric point
5.41
Protein length
1148 aaSequenceBlast
Gene length
3447 bpSequenceBlast
Function
replenishment of the oxaloacetate pool
Product
pyruvate carboxylase
Essential
no
Synonyms
pycA, ylaP
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1038 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,554,185  1,557,631
The protein
Catalyzed reaction/ biological activity
ATP + hydrogencarbonate + pyruvate --> ADP + H+ + oxaloacetate + phosphate (according to UniProt)
Domains
ATP-grasp domain (aa 125-321) (according to UniProt)
Biotin carboxylation domain (aa 1-457) (according to UniProt)
Pyruvate carboxyltransferase domain (aa 534-802) (according to UniProt)
Biotinyl-binding domain (aa 1071-1146) (according to UniProt)
Cofactors
biotin PubMed
Structure
3BG5 (PDB) (S. aureus) PubMed
Q9KWU4 (AlphaFold)
Effectors of protein activity
allosteric activation by acetyl-CoA PubMed
feedback inhibition by aspartate PubMed
Apo-DarB stimulates PycA activity (by increasing Vmax of the reaction) PubMed
Kinetic information
Km for pyruvate (in the presence of acetyl-CoA): 0.23 mM PubMed
Vmax 42.7 U/ mg of protein (in the absence of DarB) PubMed
Vmax 87.9 U/ mg of protein (in the presence of DarB) PubMed
Interactions
interaction with apo-DarB under conditions of potassium starvation activates PycA PubMed
the C-terminal part of PycA is required for the interaction with DarB PubMed
Localization
membrane associated PubMed
cytoplasm (homogeneously distributed throughout the cell) PubMed
Expression and Regulation
Operons
Genes
ftsW-pycA
Description
PubMed
Regulation
constitutively expressed PubMed
Regulatory mechanism
YofA: activation, PubMed, in yofA regulon
stringent response: positive regulation, due to presence of adenines at +1 and +2 positions of the transcript PubMed, in stringent response
TnrA: repression, in tnrA regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Open in new tab

ftsW→pycA

2025-04-01 15:05:24

Jstuelk

128

42ada7a92499bdc59de3374453c69f643f2221e3

268DF78C8A44483F25E1E096EBF6ED764E5F0CC4

Genes
pycA
Description
PubMed
Regulation
subject to positive stringent control upon lysine starvation PubMed
Regulatory mechanism
PurR: repression, PubMed, in purR regulon
Open in new tab

pycA

2025-03-26 01:06:43

Bzhu

129

6d5192038cc05d2eaa631e5a98ca39f5b165ea1b

A1DAB346F2913989B35C104E5275D9B6780AC739

Biological materials
Mutant
MGNA-A544 (ylaP::erm), available at the NBRP B. subtilis, Japan
GP793 (cat), available in Jörg Stülke's lab
BKE14860 (pycA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAAACTTTTCTCCCCCTTAC,  downstream forward: _UP4_TAAAAAACAAAGAGTGTATA
BKK14860 (pycA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAAACTTTTCTCCCCCTTAC,  downstream forward: _UP4_TAAAAAACAAAGAGTGTATA
Expression vectors
pGP1289 (N-terminal Strep-tag, purification from B. subtilis, for SPINE, in pGP380), available in Jörg Stülke's lab
pGP3322 (no tag, purification from B. subtilis, in pGP382) , available in Jörg Stülke's lab
pGP3458 (expression in E. coli, in pET28a), available in Jörg Stülke's lab
Two-hybrid system
available in Jörg Stülke's lab
LacZ fusion
pGP3328 (cat, based on pAC5]), available in Jörg Stülke's lab
References
Reviews
Valle M "Pyruvate Carboxylase, Structure and Function". Sub-cellular biochemistry. 2017; 83:291-322. doi:10.1007/978-3-319-46503-6_11. PMID:28271481
Adina-Zada A, Zeczycki TN, St Maurice M, Jitrapakdee S, Cleland WW, Attwood PVAllosteric regulation of the biotin-dependent enzyme pyruvate carboxylase by acetyl-CoA.Biochemical Society transactions. 2012 Jun 1; 40(3):567-72. PMID: 22616868
Adina-Zada A, Zeczycki TN, Attwood PVRegulation of the structure and activity of pyruvate carboxylase by acetyl CoA.Archives of biochemistry and biophysics. 2012 Mar 15; 519(2):118-30. PMID: 22120519
Jitrapakdee S, St Maurice M, Rayment I, Cleland WW, Wallace JC, Attwood PV Structure, mechanism and regulation of pyruvate carboxylase. The Biochemical journal. 2008 Aug 01; 413(3):369-87. doi:10.1042/BJ20080709. PMID:18613815
Jitrapakdee S, Wallace JC The biotin enzyme family: conserved structural motifs and domain rearrangements. Current protein & peptide science. 2003 Jun; 4(3):217-29. . PMID:12769720
Jitrapakdee S, Wallace JC Structure, function and regulation of pyruvate carboxylase. The Biochemical journal. 1999 May 15; 340 ( Pt 1):1-16. . PMID:10229653
Wallace JC, Jitrapakdee S, Chapman-Smith A Pyruvate carboxylase. The international journal of biochemistry & cell biology. 1998 Jan; 30(1):1-5. . PMID:9597748
Attwood PV The structure and the mechanism of action of pyruvate carboxylase. The international journal of biochemistry & cell biology. 1995 Mar; 27(3):231-49. . PMID:7780827
Original Publications
Krüger L, Herzberg C, Wicke D, Scholz P, Schmitt K, Turdiev A, Lee VT, Ischebeck T, Stülke JSustained Control of Pyruvate Carboxylase by the Essential Second Messenger Cyclic di-AMP in Bacillus subtilis.mBio. 2022 Feb 8; :e0360221. PMID: 35130724
Anderson BW, Schumacher MA, Yang J, Turdiev A, Turdiev H, Schroeder JW, He Q, Lee VT, Brennan RG, Wang JDThe nucleotide messenger (p)ppGpp is an anti-inducer of the purine synthesis transcription regulator PurR in Bacillus.Nucleic acids research. 2021 Dec 30; . PMID: 34967415
Mirouze N, Bidnenko E, Noirot P, Auger S Genome-wide mapping of TnrA-binding sites provides new insights into the TnrA regulon in Bacillus subtilis. MicrobiologyOpen. 2015 Jun; 4(3):423-35. doi:10.1002/mbo3.249. PMID:25755103
Monahan LG, Hajduk IV, Blaber SP, Charles IG, Harry EJ Coordinating bacterial cell division with nutrient availability: a role for glycolysis. mBio. 2014 May 13; 5(3):e00935-14. doi:10.1128/mBio.00935-14. pii:e00935-14. PMID:24825009
Henke SK, Cronan JE Successful conversion of the Bacillus subtilis BirA Group II biotin protein ligase into a Group I ligase. PloS one. 2014; 9(5):e96757. doi:10.1371/journal.pone.0096757. PMID:24816803
Tojo S, Kumamoto K, Hirooka K, Fujita Y Heavy involvement of stringent transcription control depending on the adenine or guanine species of the transcription initiation site in glucose and pyruvate metabolism in Bacillus subtilis. Journal of bacteriology. 2010 Mar; 192(6):1573-85. doi:10.1128/JB.01394-09. PMID:20081037
Hahne H, Wolff S, Hecker M, Becher D From complementarity to comprehensiveness--targeting the membrane proteome of growing Bacillus subtilis by divergent approaches. Proteomics. 2008 Oct; 8(19):4123-36. doi:10.1002/pmic.200800258. PMID:18763711
Xiang S, Tong L Crystal structures of human and Staphylococcus aureus pyruvate carboxylase and molecular insights into the carboxyltransfer reaction. Nature structural & molecular biology. 2008 Mar; 15(3):295-302. doi:10.1038/nsmb.1393. PMID:18297087
Diesterhaft MD, Freese ERole of pyruvate carboxylase, phosphoenolpyruvate carboxykinase, and malic enzyme during growth and sporulation of Bacillus subtilis.The Journal of biological chemistry. 1973 Sep 10; 248(17):6062-70. PMID: 4146915

6ABF79C6EEF078E4F71F569FACCA80DA67191AE2

Page visits: 7756

Time of last update: 2025-04-07 03:27:55

Author of last update: Jstuelk