gltB

gltB
168

small subunit of glutamate synthase

Locus
BSU_18440
Molecular weight
54.78 kDa
Isoelectric point
7.7
Protein length
493 aaSequenceBlast
Gene length
1482 bpSequenceBlast
Function
glutamate biosynthesis
Product
glutamate synthase (small subunit)
Essential
no
E.C.
1.4.1.13
Synonyms
gltB
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0493 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,008,572  2,010,053
Phenotypes of a mutant
auxotrophic for glutamate PubMed, can be bypassed by inactivation of citG and ansR (as a result of ansA-ansB derepression)PubMed
The protein
Catalyzed reaction/ biological activity
2 L-glutamate + NADP+ --> 2-oxoglutarate + H+ + L-glutamine + NADPH (according to UniProt)
Protein family
glutamate synthase family (with GltA and YerD, according to UniProt)
Domains
nucleotide binding domain (NADP) (299313)
Cofactors
two 4Fe-4S clusters reference
Structure
2VDC (PDB) (the GltA-GltB complex of Azospirillum brasiliense) PubMed, note that B. subtilis GltA is unable to form dimers, thus GltA-GltB exists as a heterodimer PubMed
7MFT (PDB) (the GudB6-(GltA-GltB)6 complex) PubMed
O34399 (AlphaFold)
Localization
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
Genes
gltA-gltB
Description
PubMed
Regulation
expressed in the presence of ammonium PubMed
Regulatory mechanism
TnrA: repression, PubMed, in tnrA regulon
GltC: activation, PubMed, in gltC regulon
Fur: indirect effect, in fur regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Open in new tab

gltA→gltB

2025-04-05 06:00:24

Bzhu

137

90b560615ccdd0da363a7f12dfb0b2af980e6000

F7C02591D79E87C32CC816954DB16451EB2276C9

Other regulations
FsrA: translation inhibition
Biological materials
Mutant
BP123 (ΔgltA-gltB::ermC) , available in Fabian Commichau's lab
GP807 (ΔgltA-gltB::tet) , available in Jörg Stülke's lab
GP517 (ΔgltB::ermC), available in Jörg Stülke's lab
BKE18440 (gltB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTCCTCTCCCCTTCCT,  downstream forward: _UP4_TAAATAAAGGGGATTATCAT
BKK18440 (gltB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTCCTCTCCCCTTCCT,  downstream forward: _UP4_TAAATAAAGGGGATTATCAT
Expression vectors
pGP1119 (in pGP380, for SPINE, expression in B. subtilis), available in Jörg Stülke's lab PubMed
pGP3031: IPTG inducible expression, purification in E. coli with C-terminal His-tag, in pGP574 (Strep-tag omitted), available in Jörg Stülke's lab
pGP3032: IPTG inducible expression, purification in E. coli with C-terminal Strep-tag, in pGP574, available in Jörg Stülke's lab
Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab
LacZ fusion
see ''gltA
Labs working on this gene/protein
Linc Sonenshein, Tufts University, Boston, MA, USA Homepage
Fabian Commichau, Göttingen, Germany homepage
References
Reviews
Gunka K, Commichau FM Control of glutamate homeostasis in Bacillus subtilis: a complex interplay between ammonium assimilation, glutamate biosynthesis and degradation. Molecular microbiology. 2012 Jul; 85(2):213-24. doi:10.1111/j.1365-2958.2012.08105.x. PMID:22625175
Suzuki A, Knaff DB Glutamate synthase: structural, mechanistic and regulatory properties, and role in the amino acid metabolism. Photosynthesis research. 2005; 83(2):191-217. . PMID:16143852
Raushel FM, Thoden JB, Holden HM Enzymes with molecular tunnels. Accounts of chemical research. 2003 Jul; 36(7):539-48. . PMID:12859215
Raushel FM, Thoden JB, Holden HM Enzymes with molecular tunnels. Accounts of chemical research. 2003 Jul; 36(7):539-48. . PMID:12859215
Original Publications
Mardoukhi MSY, Rapp J, Irisarri I, Gunka K, Link H, Marienhagen J, de Vries J, Stülke J, Commichau FMMetabolic rewiring enables ammonium assimilation via a non-canonical fumarate-based pathway.Microbial biotechnology. 2024 Mar; 17(3):e14429. PMID: 38483038
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Jayaraman V, Lee DJ, Elad N, Vimer S, Sharon M, Fraser JS, Tawfik DSA counter-enzyme complex regulates glutamate metabolism in Bacillus subtilis.Nature chemical biology. 2021 Dec 20; . PMID: 34931064
Reuß DR, Rath H, Thürmer A, Benda M, Daniel R, Völker U, Mäder U, Commichau FM, Stülke J Changes of DNA topology affect the global transcription landscape and allow rapid growth of a Bacillus subtilis lacking carbon catabolite repression. Metabolic engineering. 2017 Dec 11; . pii:S1096-7176(17)30231-8. doi:10.1016/j.ymben.2017.12.004. PMID:29242163
Dormeyer M, Lübke AL, Müller P, Lentes S, Reuß DR, Thürmer A, Stülke J, Daniel R, Brantl S, Commichau FM Hierarchical mutational events compensate for glutamate auxotrophy of a Bacillus subtilis gltC mutant. Environmental microbiology reports. 2017 Mar 13; . doi:10.1111/1758-2229.12531. PMID:28294562
Zhou H, Luo C, Fang X, Xiang Y, Wang X, Zhang R, Chen Z Loss of GltB Inhibits Biofilm Formation and Biocontrol Efficiency of Bacillus subtilis Bs916 by Altering the Production of γ-Polyglutamate and Three Lipopeptides. PloS one. 2016; 11(5):e0156247. doi:10.1371/journal.pone.0156247. PMID:27223617
Mirouze N, Bidnenko E, Noirot P, Auger S Genome-wide mapping of TnrA-binding sites provides new insights into the TnrA regulon in Bacillus subtilis. MicrobiologyOpen. 2015 Jun; 4(3):423-35. doi:10.1002/mbo3.249. PMID:25755103
Smaldone GT, Revelles O, Gaballa A, Sauer U, Antelmann H, Helmann JD A global investigation of the Bacillus subtilis iron-sparing response identifies major changes in metabolism. Journal of bacteriology. 2012 May; 194(10):2594-605. doi:10.1128/JB.05990-11. PMID:22389480
Meyer FM, Gerwig J, Hammer E, Herzberg C, Commichau FM, Völker U, Stülke J Physical interactions between tricarboxylic acid cycle enzymes in Bacillus subtilis: evidence for a metabolon. Metabolic engineering. 2011 Jan; 13(1):18-27. doi:10.1016/j.ymben.2010.10.001. PMID:20933603
Commichau FM, Gunka K, Landmann JJ, Stülke J Glutamate metabolism in Bacillus subtilis: gene expression and enzyme activities evolved to avoid futile cycles and to allow rapid responses to perturbations of the system. Journal of bacteriology. 2008 May; 190(10):3557-64. doi:10.1128/JB.00099-08. PMID:18326565
Cottevieille M, Larquet E, Jonic S, Petoukhov MV, Caprini G, Paravisi S, Svergun DI, Vanoni MA, Boisset N The subnanometer resolution structure of the glutamate synthase 1.2-MDa hexamer by cryoelectron microscopy and its oligomerization behavior in solution: functional implications. The Journal of biological chemistry. 2008 Mar 28; 283(13):8237-49. doi:10.1074/jbc.M708529200. PMID:18199747
Commichau FM, Herzberg C, Tripal P, Valerius O, Stülke J A regulatory protein-protein interaction governs glutamate biosynthesis in Bacillus subtilis: the glutamate dehydrogenase RocG moonlights in controlling the transcription factor GltC. Molecular microbiology. 2007 Aug; 65(3):642-54. . PMID:17608797
Commichau FM, Wacker I, Schleider J, Blencke HM, Reif I, Tripal P, Stülke J Characterization of Bacillus subtilis mutants with carbon source-independent glutamate biosynthesis. Journal of molecular microbiology and biotechnology. 2007; 12(1-2):106-13. . PMID:17183217
Picossi S, Belitsky BR, Sonenshein AL Molecular mechanism of the regulation of Bacillus subtilis gltAB expression by GltC. Journal of molecular biology. 2007 Feb 02; 365(5):1298-313. . PMID:17134717
Belitsky BR, Sonenshein AL Modulation of activity of Bacillus subtilis regulatory proteins GltC and TnrA by glutamate dehydrogenase. Journal of bacteriology. 2004 Jun; 186(11):3399-407. . PMID:15150225
Wacker I, Ludwig H, Reif I, Blencke HM, Detsch C, Stülke J The regulatory link between carbon and nitrogen metabolism in Bacillus subtilis: regulation of the gltAB operon by the catabolite control protein CcpA. Microbiology (Reading, England). 2003 Oct; 149(Pt 10):3001-9. . PMID:14523131
Yoshida K, Yamaguchi H, Kinehara M, Ohki YH, Nakaura Y, Fujita Y Identification of additional TnrA-regulated genes of Bacillus subtilis associated with a TnrA box. Molecular microbiology. 2003 Jul; 49(1):157-65. . PMID:12823818
Yoshida K, Yamaguchi H, Kinehara M, Ohki YH, Nakaura Y, Fujita Y Identification of additional TnrA-regulated genes of Bacillus subtilis associated with a TnrA box. Molecular microbiology. 2003 Jul; 49(1):157-65. . PMID:12823818
Belitsky BR, Wray LV, Fisher SH, Bohannon DE, Sonenshein AL Role of TnrA in nitrogen source-dependent repression of Bacillus subtilis glutamate synthase gene expression. Journal of bacteriology. 2000 Nov; 182(21):5939-47. . PMID:11029411
Belitsky BR, Sonenshein AL Mutations in GltC that increase Bacillus subtilis gltA expression. Journal of bacteriology. 1995 Oct; 177(19):5696-700. . PMID:7559360
Bohannon DE, Sonenshein AL Positive regulation of glutamate biosynthesis in Bacillus subtilis. Journal of bacteriology. 1989 Sep; 171(9):4718-27. . PMID:2548995

AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A

Page visits: 6832

Time of last update: 2025-04-06 12:08:18

Author of last update: Jstuelk