gltA

gltA
168

large subunit of glutamate synthase, controls GudB activity

Locus
BSU_18450
Molecular weight
168.61 kDa
Isoelectric point
5.47
Protein length
1520 aaSequenceBlast
Gene length
4563 bpSequenceBlast
Function
glutamate biosynthesis and control of glutamate degradation
Product
glutamate synthase (large subunit)
Essential
no
E.C.
1.4.1.13
Synonyms
gltA
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0070 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,010,070  2,014,632
Phenotypes of a mutant
auxotrophic for glutamate PubMed, can be bypassed by inactivation of citG and ansR (as a result of ansA-ansB derepression)PubMed
The protein
Catalyzed reaction/ biological activity
2 L-glutamate + NADP+ --> 2-oxoglutarate + H+ + L-glutamine + NADPH (according to UniProt)
binding to GudB to inhibit glutamate degradation in the absence of glutamate PubMed
Protein family
glutamate synthase family (with YerD and GltB, according to UniProt)
Domains
Glutamine amidotransferase type-2 domain (aa 22-415) (according to UniProt)
Nucleotide binding domain (1060-1112)
Cofactors
one 3Fe-4S cluster PubMed
FMN PubMed
Structure
7MFT (PDB) (the GudB6-(GltA-GltB)6 complex) PubMed
2VDC (PDB) (the GltA-GltB complex of Azospirillum brasiliense) PubMed, note that the B. subtilis protein is unable to form dimers, thus GltA-GltB exists as a heterodimer PubMed
P39812 (AlphaFold)
Modification
phosphorylated on Arg-904 AND/OR Arg-914 PubMed
Paralogous protein(s)
YerD
Localization
membrane associated PubMed, cytoplasm (according to UniProt)
Additional information
subject to Clp-dependent proteolysis upon glucose starvation PubMed
translation is likely to require Efp due to the presence of several consecutive proline residues PubMed
Expression and Regulation
Operons
Genes
gltA-gltB
Description
PubMed
Regulation
expressed in the presence of ammonium PubMed
Regulatory mechanism
TnrA: repression, PubMed, in tnrA regulon
GltC: activation, PubMed, in gltC regulon
Fur: indirect effect, in fur regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Open in new tab

gltA→gltB

2025-03-17 17:35:45

Bzhu

136

90b560615ccdd0da363a7f12dfb0b2af980e6000

F7C02591D79E87C32CC816954DB16451EB2276C9

Other regulations
FsrA: translation inhibition, PubMed
Biological materials
Mutant
GP3906 (ΔgltA::aphA3), available in Jörg Stülke's lab
BP123 (ΔgltA-gltB::ermC) , available in Fabian Commichau's lab
GP807 (ΔgltA-gltB::tet) , available in Jörg Stülke's lab
GP222 (gltA under the control of p-xyl), available in Jörg Stülke's lab
1A808 ( gltA::cat), PubMed, available at BGSC
1A809 ( gltA::kan), PubMed, available at BGSC
BKE18450 (gltA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAATTCCTCTCCCCCGAT,  downstream forward: _UP4_GTACAGTAAGGAAGGGGAGA
BKK18450 (gltA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAATTCCTCTCCCCCGAT,  downstream forward: _UP4_GTACAGTAAGGAAGGGGAGA
Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab
LacZ fusion
pGP526 (in pAC7), available in Jörg Stülke's lab PubMed
pGP919 (in pAC5), available in Jörg Stülke's lab PubMed
Labs working on this gene/protein
Linc Sonenshein, Tufts University, Boston, MA, USA Homepage
Jörg Stülke, University of Göttingen, Germany Homepage
Fabian Commichau Brandenburg Technical University Cottbus-Senftenberg, Germany Homepage
References
Reviews
Fernie AR, Zhang YThe Bacillus subtilis glutamate anti-metabolon.Nature metabolism. 2022 Feb 7; . PMID: 35132259
Hartmann MDA complex struggle for direction.Nature chemical biology. 2021 Dec 20; . PMID: 34931063
Gunka K, Commichau FM Control of glutamate homeostasis in Bacillus subtilis: a complex interplay between ammonium assimilation, glutamate biosynthesis and degradation. Molecular microbiology. 2012 Jul; 85(2):213-24. doi:10.1111/j.1365-2958.2012.08105.x. PMID:22625175
Suzuki A, Knaff DB Glutamate synthase: structural, mechanistic and regulatory properties, and role in the amino acid metabolism. Photosynthesis research. 2005; 83(2):191-217. . PMID:16143852
Raushel FM, Thoden JB, Holden HM Enzymes with molecular tunnels. Accounts of chemical research. 2003 Jul; 36(7):539-48. . PMID:12859215
Raushel FM, Thoden JB, Holden HM Enzymes with molecular tunnels. Accounts of chemical research. 2003 Jul; 36(7):539-48. . PMID:12859215
Original Publications
Mardoukhi MSY, Rapp J, Irisarri I, Gunka K, Link H, Marienhagen J, de Vries J, Stülke J, Commichau FMMetabolic rewiring enables ammonium assimilation via a non-canonical fumarate-based pathway.Microbial biotechnology. 2024 Mar; 17(3):e14429. PMID: 38483038
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Jayaraman V, Lee DJ, Elad N, Vimer S, Sharon M, Fraser JS, Tawfik DSA counter-enzyme complex regulates glutamate metabolism in Bacillus subtilis.Nature chemical biology. 2021 Dec 20; . PMID: 34931064
Kimura T, Kobayashi K Role of glutamate synthase in biofilm formation by . Journal of bacteriology. 2020 May 11; . pii:JB.00120-20. doi:10.1128/JB.00120-20. PMID:32393519
Dormeyer M, Lentes S, Richts B, Heermann R, Ischebeck T, Commichau FM Variants of the LysR-Type Regulator GltC With Altered Activator and Repressor Function. Frontiers in microbiology. 2019; 10:2321. doi:10.3389/fmicb.2019.02321. PMID:31649652
Reuß DR, Rath H, Thürmer A, Benda M, Daniel R, Völker U, Mäder U, Commichau FM, Stülke J Changes of DNA topology affect the global transcription landscape and allow rapid growth of a Bacillus subtilis lacking carbon catabolite repression. Metabolic engineering. 2017 Dec 11; . pii:S1096-7176(17)30231-8. doi:10.1016/j.ymben.2017.12.004. PMID:29242163
Liu J, Martinez-Corral R, Prindle A, Lee DD, Larkin J, Gabalda-Sagarra M, Garcia-Ojalvo J, Süel GM Coupling between distant biofilms and emergence of nutrient time-sharing. Science (New York, N.Y.). 2017 May 12; 356(6338):638-642. doi:10.1126/science.aah4204. PMID:28386026
Dormeyer M, Lübke AL, Müller P, Lentes S, Reuß DR, Thürmer A, Stülke J, Daniel R, Brantl S, Commichau FM Hierarchical mutational events compensate for glutamate auxotrophy of a Bacillus subtilis gltC mutant. Environmental microbiology reports. 2017 Mar 13; . doi:10.1111/1758-2229.12531. PMID:28294562
Mirouze N, Bidnenko E, Noirot P, Auger S Genome-wide mapping of TnrA-binding sites provides new insights into the TnrA regulon in Bacillus subtilis. MicrobiologyOpen. 2015 Jun; 4(3):423-35. doi:10.1002/mbo3.249. PMID:25755103
Elsholz AK, Turgay K, Michalik S, Hessling B, Gronau K, Oertel D, Mäder U, Bernhardt J, Becher D, Hecker M, Gerth U Global impact of protein arginine phosphorylation on the physiology of Bacillus subtilis. Proceedings of the National Academy of Sciences of the United States of America. 2012 May 08; 109(19):7451-6. doi:10.1073/pnas.1117483109. PMID:22517742
Smaldone GT, Revelles O, Gaballa A, Sauer U, Antelmann H, Helmann JD A global investigation of the Bacillus subtilis iron-sparing response identifies major changes in metabolism. Journal of bacteriology. 2012 May; 194(10):2594-605. doi:10.1128/JB.05990-11. PMID:22389480
Meyer FM, Gerwig J, Hammer E, Herzberg C, Commichau FM, Völker U, Stülke J Physical interactions between tricarboxylic acid cycle enzymes in Bacillus subtilis: evidence for a metabolon. Metabolic engineering. 2011 Jan; 13(1):18-27. doi:10.1016/j.ymben.2010.10.001. PMID:20933603
Hahne H, Wolff S, Hecker M, Becher D From complementarity to comprehensiveness--targeting the membrane proteome of growing Bacillus subtilis by divergent approaches. Proteomics. 2008 Oct; 8(19):4123-36. doi:10.1002/pmic.200800258. PMID:18763711
Commichau FM, Gunka K, Landmann JJ, Stülke J Glutamate metabolism in Bacillus subtilis: gene expression and enzyme activities evolved to avoid futile cycles and to allow rapid responses to perturbations of the system. Journal of bacteriology. 2008 May; 190(10):3557-64. doi:10.1128/JB.00099-08. PMID:18326565
Cottevieille M, Larquet E, Jonic S, Petoukhov MV, Caprini G, Paravisi S, Svergun DI, Vanoni MA, Boisset N The subnanometer resolution structure of the glutamate synthase 1.2-MDa hexamer by cryoelectron microscopy and its oligomerization behavior in solution: functional implications. The Journal of biological chemistry. 2008 Mar 28; 283(13):8237-49. doi:10.1074/jbc.M708529200. PMID:18199747
Gerth U, Kock H, Kusters I, Michalik S, Switzer RL, Hecker M Clp-dependent proteolysis down-regulates central metabolic pathways in glucose-starved Bacillus subtilis. Journal of bacteriology. 2008 Jan; 190(1):321-31. . PMID:17981983
Commichau FM, Herzberg C, Tripal P, Valerius O, Stülke J A regulatory protein-protein interaction governs glutamate biosynthesis in Bacillus subtilis: the glutamate dehydrogenase RocG moonlights in controlling the transcription factor GltC. Molecular microbiology. 2007 Aug; 65(3):642-54. . PMID:17608797
Commichau FM, Wacker I, Schleider J, Blencke HM, Reif I, Tripal P, Stülke J Characterization of Bacillus subtilis mutants with carbon source-independent glutamate biosynthesis. Journal of molecular microbiology and biotechnology. 2007; 12(1-2):106-13. . PMID:17183217
Picossi S, Belitsky BR, Sonenshein AL Molecular mechanism of the regulation of Bacillus subtilis gltAB expression by GltC. Journal of molecular biology. 2007 Feb 02; 365(5):1298-313. . PMID:17134717
Miethke M, Westers H, Blom EJ, Kuipers OP, Marahiel MA Iron starvation triggers the stringent response and induces amino acid biosynthesis for bacillibactin production in Bacillus subtilis. Journal of bacteriology. 2006 Dec; 188(24):8655-7. . PMID:17012385
Belitsky BR, Sonenshein AL Modulation of activity of Bacillus subtilis regulatory proteins GltC and TnrA by glutamate dehydrogenase. Journal of bacteriology. 2004 Jun; 186(11):3399-407. . PMID:15150225
Wacker I, Ludwig H, Reif I, Blencke HM, Detsch C, Stülke J The regulatory link between carbon and nitrogen metabolism in Bacillus subtilis: regulation of the gltAB operon by the catabolite control protein CcpA. Microbiology (Reading, England). 2003 Oct; 149(Pt 10):3001-9. . PMID:14523131
Blencke HM, Homuth G, Ludwig H, Mäder U, Hecker M, Stülke J Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways. Metabolic engineering. 2003 Apr; 5(2):133-49. . PMID:12850135
Yoshida K, Yamaguchi H, Kinehara M, Ohki YH, Nakaura Y, Fujita Y Identification of additional TnrA-regulated genes of Bacillus subtilis associated with a TnrA box. Molecular microbiology. 2003 Jul; 49(1):157-65. . PMID:12823818
Yoshida K, Yamaguchi H, Kinehara M, Ohki YH, Nakaura Y, Fujita Y Identification of additional TnrA-regulated genes of Bacillus subtilis associated with a TnrA box. Molecular microbiology. 2003 Jul; 49(1):157-65. . PMID:12823818
van den Heuvel RH, Ferrari D, Bossi RT, Ravasio S, Curti B, Vanoni MA, Florencio FJ, Mattevi A Structural studies on the synchronization of catalytic centers in glutamate synthase. The Journal of biological chemistry. 2002 Jul 05; 277(27):24579-83. . PMID:11967268
Belitsky BR, Wray LV, Fisher SH, Bohannon DE, Sonenshein AL Role of TnrA in nitrogen source-dependent repression of Bacillus subtilis glutamate synthase gene expression. Journal of bacteriology. 2000 Nov; 182(21):5939-47. . PMID:11029411
Belitsky BR, Sonenshein AL Mutations in GltC that increase Bacillus subtilis gltA expression. Journal of bacteriology. 1995 Oct; 177(19):5696-700. . PMID:7559360
Bohannon DE, Sonenshein AL Positive regulation of glutamate biosynthesis in Bacillus subtilis. Journal of bacteriology. 1989 Sep; 171(9):4718-27. . PMID:2548995

44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0

Page visits: 10852

Time of last update: 2025-04-04 14:41:42

Author of last update: Jstuelk