prkC
168

protein kinase C, fine-tuning of cell growth rates in response to Lipid II in different nutrient conditions, induces Germination of spores in response to DAP-type, and not to Lys-type cell wall muropeptides, stimulates WalR activity

Locus

BSU_15770

Molecular weight

71.69 kDa

Isoelectric point

4.83

Protein length

648 aaSequenceBlast

Gene length

1947 bpSequenceBlast

Function

regulation of growth and germination in response to muropeptides and Lipid II

Product

protein kinase

Essential

E.C.

2.7.11.1

Synonyms

prkC, yloP

Outlinks

BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2815 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene

Coordinates

1,651,142 1,653,088

Phenotypes of a mutant

unable to germinate in response to muropeptides PubMed

reduced growth at high salt PubMed

The protein

Catalyzed reaction/ biological activity

phosphorylation of WalR on Thr-101 to stimulate its activity PubMed

phosphorylates PrkA on Thr-217 PubMed

phosphorylation of RodZ in response to lipid II abundance PubMed

Protein family

protein kinase superfamily (according to UniProt)

Ser/Thr protein kinase family (according to UniProt)

Domains

contains three C-terminal PASTA domains (aa 356-424, 425-492, 493-559) (binds muropeptides) PubMed

Protein kinase domain (aa 11-271) (according to UniProt)

Structure

4EQM (PDB) (intracellular domain of the Staphylococcus aureus enzyme, 51% identity) PubMed

3PY9 (PDB) (entire extra-cellular region of PrkC from Staphylococcus aureus) PubMed

4X3F (PDB) (intracellular domain of the Mycobacterium tuberculosis enzyme, 36% identity, 68% similarity) PubMed

O34507 (AlphaFold)

Modification

phosphorylation on Thr-290 PubMed, autophosphorylation on multiple threonine residues PubMed

Effectors of protein activity

activated by muropeptides PubMed

lipid II PubMed

GpsB, DivIVA, and EzrA are required for stimulation of PrkC activity PubMed

Localization

inner spore membrane PubMed

membrane PubMed

division septum PubMed

Expression and Regulation

Operons

Genes

prpC-prkC-cpgA-rpeA-yloS

Description

PubMed

Open in new tab

Biological materials

Mutant

MGNA-B134 (yloP::erm), available at the NBRP B. subtilis, Japan

GP576 (spc), OMG302 (aphA3), available in Jörg Stülke's lab

1A820 ( prkC::erm), PubMed, available at BGSC

1A963 (no resistance), PubMed, available at BGSC

1A964 (no resistance), PubMed, available at BGSC

BKE15770 (prkC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GATTAGCACTGATCTTCACC, downstream forward: _UP4_GATGAATAACAAGGAGGGAA

BKK15770 (prkC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GATTAGCACTGATCTTCACC, downstream forward: _UP4_GATGAATAACAAGGAGGGAA

Expression vectors

for expression/ purification from B. subtilis with N-terminal Strep-tag, for SPINE, in pGP380: pGP832, available in Jörg Stülke's lab

for expression/ purification of the kinase domain from B. subtilis with N-terminal Strep-tag, for SPINE, in pGP380: pGP849, available in Jörg Stülke's lab

for expression, purification in E. coli with N-terminal His-tag, in pWH844: pGP1001, available in Jörg Stülke's lab

for expression, purification in E. coli with N-terminal Strep-tag, in pGP172: pGP825, available in Jörg Stülke's lab, PubMed

LacZ fusion

pGP829 (in pAC7), available in Jörg Stülke's lab

References

Reviews

Hammond LR, White ML, Eswara PJ ¡vIVA la DivIVA! Journal of bacteriology. 2019 Aug 12; . pii:JB.00245-19. doi:10.1128/JB.00245-19. PMID:31405912

Pompeo F, Foulquier E, Galinier A Impact of Serine/Threonine Protein Kinases on the Regulation of Sporulation in Bacillus subtilis. Frontiers in microbiology. 2016; 7:568. doi:10.3389/fmicb.2016.00568. PMID:27148245

Manuse S, Fleurie A, Zucchini L, Lesterlin C, Grangeasse C Role of eukaryotic-like serine/threonine kinases in bacterial cell division and morphogenesis. FEMS microbiology reviews. 2016 Jan; 40(1):41-56. doi:10.1093/femsre/fuv041. PMID:26429880

Pereira SF, Goss L, Dworkin J Eukaryote-like serine/threonine kinases and phosphatases in bacteria. Microbiology and molecular biology reviews : MMBR. 2011 Mar; 75(1):192-212. doi:10.1128/MMBR.00042-10. PMID:21372323

Dworkin J, Shah IM Exit from dormancy in microbial organisms. Nature reviews. Microbiology. 2010 Dec; 8(12):890-6. doi:10.1038/nrmicro2453. PMID:20972452

Phosphorylation of PrkC

Gruszczyński P, Obuchowski M, Kaźmierkiewicz R Phosphorylation and ATP-binding induced conformational changes in the PrkC, Ser/Thr kinase from B. subtilis. Journal of computer-aided molecular design. 2010 Sep; 24(9):733-47. doi:10.1007/s10822-010-9370-4. PMID:20563625

Madec E, Stensballe A, Kjellström S, Cladière L, Obuchowski M, Jensen ON, Séror SJ Mass spectrometry and site-directed mutagenesis identify several autophosphorylated residues required for the activity of PrkC, a Ser/Thr kinase from Bacillus subtilis. Journal of molecular biology. 2003 Jul 11; 330(3):459-72. . PMID:12842463

Phsiological role of PrkC

Sun Y, Hürlimann S, Garner EGrowth rate is modulated by monitoring cell wall precursors in Bacillus subtilis.Nature microbiology. 2023 Mar; 8(3):469-480. PMID: 36797487

Libby EA, Reuveni S, Dworkin J Multisite phosphorylation drives phenotypic variation in (p)ppGpp synthetase-dependent antibiotic tolerance. Nature communications. 2019 Nov 13; 10(1):5133. doi:10.1038/s41467-019-13127-z. PMID:31723135

Libby EA, Goss LA, Dworkin J The Eukaryotic-Like Ser/Thr Kinase PrkC Regulates the Essential WalRK Two-Component System in Bacillus subtilis. PLoS genetics. 2015 Jun; 11(6):e1005275. doi:10.1371/journal.pgen.1005275. PMID:26102633

Absalon C, Obuchowski M, Madec E, Delattre D, Holland IB, Séror SJ CpgA, EF-Tu and the stressosome protein YezB are substrates of the Ser/Thr kinase/phosphatase couple, PrkC/PrpC, in Bacillus subtilis. Microbiology (Reading, England). 2009 Mar; 155(Pt 3):932-43. doi:10.1099/mic.0.022475-0. PMID:19246764

Shah IM, Laaberki MH, Popham DL, Dworkin J A eukaryotic-like Ser/Thr kinase signals bacteria to exit dormancy in response to peptidoglycan fragments. Cell. 2008 Oct 31; 135(3):486-96. doi:10.1016/j.cell.2008.08.039. PMID:18984160

Madec E, Laszkiewicz A, Iwanicki A, Obuchowski M, Séror S Characterization of a membrane-linked Ser/Thr protein kinase in Bacillus subtilis, implicated in developmental processes. Molecular microbiology. 2002 Oct; 46(2):571-86. . PMID:12406230

Gaidenko TA, Kim TJ, Price CW The PrpC serine-threonine phosphatase and PrkC kinase have opposing physiological roles in stationary-phase Bacillus subtilis cells. Journal of bacteriology. 2002 Nov; 184(22):6109-14. . PMID:12399479

Structure/ biochemistry of PrkC

Berisio R, Squeglia F, Ruggiero A, Petraccone L, Stellato MI, Del Vecchio P Differential thermodynamic behaviours of the extra-cellular regions of two Ser/Thr PrkC kinases revealed by calorimetric studies. Biochimica et biophysica acta. 2015 May; 1854(5):402-9. doi:10.1016/j.bbapap.2015.02.001. pii:S1570-9639(15)00036-9. PMID:25668224

Wagner T, Alexandre M, Duran R, Barilone N, Wehenkel A, Alzari PM, Bellinzoni M The crystal structure of the catalytic domain of the ser/thr kinase PknA from M. tuberculosis shows an Src-like autoinhibited conformation. Proteins. 2015 May; 83(5):982-8. doi:10.1002/prot.24754. PMID:25586004

Arora G, Sajid A, Arulanandh MD, Misra R, Singhal A, Kumar S, Singh LK, Mattoo AR, Raj R, Maiti S, Basu-Modak S, Singh Y Zinc regulates the activity of kinase-phosphatase pair (BasPrkC/BasPrpC) in Bacillus anthracis. Biometals : an international journal on the role of metal ions in biology, biochemistry, and medicine. 2013 Oct; 26(5):715-30. doi:10.1007/s10534-013-9646-y. PMID:23793375

Rakette S, Donat S, Ohlsen K, Stehle T Structural analysis of Staphylococcus aureus serine/threonine kinase PknB. PloS one. 2012; 7(6):e39136. doi:10.1371/journal.pone.0039136. PMID:22701750

Squeglia F, Marchetti R, Ruggiero A, Lanzetta R, Marasco D, Dworkin J, Petoukhov M, Molinaro A, Berisio R, Silipo A Chemical basis of peptidoglycan discrimination by PrkC, a key kinase involved in bacterial resuscitation from dormancy. Journal of the American Chemical Society. 2011 Dec 28; 133(51):20676-9. doi:10.1021/ja208080r. PMID:22111897

Ruggiero A, Squeglia F, Marasco D, Marchetti R, Molinaro A, Berisio R X-ray structural studies of the entire extracellular region of the serine/threonine kinase PrkC from Staphylococcus aureus. The Biochemical journal. 2011 Apr 01; 435(1):33-41. doi:10.1042/BJ20101643. PMID:21208192

Expression/ localization of PrkC

Pompeo F, Byrne D, Mengin-Lecreulx D, Galinier A Dual regulation of activity and intracellular localization of the PASTA kinase PrkC during Bacillus subtilis growth. Scientific reports. 2018 Jan 26; 8(1):1660. doi:10.1038/s41598-018-20145-2. PMID:29374241

Zheng L, Abhyankar W, Ouwerling N, Dekker HL, van Veen H, van der Wel NN, Roseboom W, de Koning LJ, Brul S, de Koster CG Bacillus subtilis Spore Inner Membrane Proteome. Journal of proteome research. 2016 Feb 05; 15(2):585-94. doi:10.1021/acs.jproteome.5b00976. PMID:26731423

Chen Y, Ray WK, Helm RF, Melville SB, Popham DL Levels of germination proteins in Bacillus subtilis dormant, superdormant, and germinating spores. PloS one. 2014; 9(4):e95781. doi:10.1371/journal.pone.0095781. PMID:24752279

Iwanicki A, Hinc K, Seror S, Wegrzyn G, Obuchowski M Transcription in the prpC-yloQ region in Bacillus subtilis. Archives of microbiology. 2005 Sep; 183(6):421-30. . PMID:16025310

Targets of PrkC-dependent phosphorylation

Zhang A, Lebrun R, Espinosa L, Galinier A, Pompeo FPrkA is an ATP-dependent protease that regulates sporulation in Bacillus subtilis.The Journal of biological chemistry. 2022 Aug 27; :102436. PMID: 36041628

Pompeo F, Rismondo J, Gründling A, Galinier A Investigation of the phosphorylation of Bacillus subtilis LTA synthases by the serine/threonine kinase PrkC. Scientific reports. 2018 Nov 26; 8(1):17344. doi:10.1038/s41598-018-35696-7. PMID:30478337

Pompeo F, Foulquier E, Serrano B, Grangeasse C, Galinier A Phosphorylation of the cell division protein GpsB regulates PrkC kinase activity through a negative feedback loop in Bacillus subtilis. Molecular microbiology. 2015 Jul; 97(1):139-50. doi:10.1111/mmi.13015. PMID:25845974

Shi L, Pigeonneau N, Ravikumar V, Dobrinic P, Macek B, Franjevic D, Noirot-Gros MF, Mijakovic I Cross-phosphorylation of bacterial serine/threonine and tyrosine protein kinases on key regulatory residues. Frontiers in microbiology. 2014; 5:495. doi:10.3389/fmicb.2014.00495. PMID:25278935

Foulquier E, Pompeo F, Freton C, Cordier B, Grangeasse C, Galinier A PrkC-mediated phosphorylation of overexpressed YvcK protein regulates PBP1 protein localization in Bacillus subtilis mreB mutant cells. The Journal of biological chemistry. 2014 Aug 22; 289(34):23662-9. doi:10.1074/jbc.M114.562496. PMID:25012659

Kobir A, Poncet S, Bidnenko V, Delumeau O, Jers C, Zouhir S, Grenha R, Nessler S, Noirot P, Mijakovic I Phosphorylation of Bacillus subtilis gene regulator AbrB modulates its DNA-binding properties. Molecular microbiology. 2014 Jun; 92(5):1129-41. doi:10.1111/mmi.12617. PMID:24731262

Ravikumar V, Shi L, Krug K, Derouiche A, Jers C, Cousin C, Kobir A, Mijakovic I, Macek B Quantitative phosphoproteome analysis of Bacillus subtilis reveals novel substrates of the kinase PrkC and phosphatase PrpC. Molecular & cellular proteomics : MCP. 2014 Aug; 13(8):1965-78. doi:10.1074/mcp.M113.035949. PMID:24390483

Pietack N, Becher D, Schmidl SR, Saier MH, Hecker M, Commichau FM, Stülke J In vitro phosphorylation of key metabolic enzymes from Bacillus subtilis: PrkC phosphorylates enzymes from different branches of basic metabolism. Journal of molecular microbiology and biotechnology. 2010; 18(3):129-40. doi:10.1159/000308512. PMID:20389117

Shah IM, Dworkin J Induction and regulation of a secreted peptidoglycan hydrolase by a membrane Ser/Thr kinase that detects muropeptides. Molecular microbiology. 2010 Mar; 75(5):1232-43. doi:10.1111/j.1365-2958.2010.07046.x. PMID:20070526

Page visits: 10259

Time of last update: 2025-04-07 11:10:12

Author of last update: Jstuelk

prkC 168

prkC
168