safA

safA
168

morphogenetic protein associated with SpoVID, major organizer of the inner spore coat

Locus
BSU_27840
Molecular weight
43.07 kDa
Isoelectric point
5.75
Protein length
387 aaSequenceBlast
Gene length
1164 bpSequenceBlast
Function
spore coat formation
Product
morphogenetic protein
Essential
no
Synonyms
safA, yrbA
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

List of homologs in different organisms, belongs to COG1388 (Galperin et al., 2021)

This gene is a member of the following regulons

SigE regulon

Gene
Coordinates
2,844,675 → 2,845,838
Phenotypes of a mutant
mis-assembly of the inner spore coat PubMed
The protein
Domains
contains a N-acetylglucosamine-polymer-binding LysM domain at the N-terminus PubMed
LysM domain (aa 2-47) (according to UniProt)
Structure
O32062 (AlphaFold)
Localization
inner spore coat  PubMed
cortex-coat interface PubMed
Expression and Regulation
Operons
Genes
safA-coxA
Description
PubMed
Regulation
expressed early during sporulation in the mother cell (SigE) PubMed
Sigma factors
SigE: sigma factor, PubMed, in sigE regulon
Open in new tab

safA→coxA

2025-04-03 14:00:56

ghost

105

12887e4fab6c1ec58f9a68216a6d2a5a398694c5

D9BDB8B92E2AC509F33C2AB81BA9EFCF29FD7237

Biological materials
Mutant
MGNA-A011 (yrbA::erm), available at the NBRP B. subtilis, Japan
1S126 ( safA::erm), PubMed, available at BGSC
1S117 ( safA::spec), PubMed, available at BGSC
BKE27840 (ΔsafA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAACGTTTTCCCCTCCTATG,  downstream forward: _UP4_TGATCGTTCGGAACGATGTA
BKK27840 (ΔsafA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAACGTTTTCCCCTCCTATG,  downstream forward: _UP4_TGATCGTTCGGAACGATGTA
Labs working on this gene/protein
Adriano Henriques, Lisbon, Portugal homepage
Charles Moran, Emory University, NC, USA homepage
References
Reviews
Galperin MY, Yutin N, Wolf YI, Vera Alvarez R, Koonin EVConservation and Evolution of the Sporulation Gene Set in Diverse Members of the Firmicutes.Journal of bacteriology. 2022 May 31; :e0007922. PMID: 35638784
McKenney PT, Driks A, Eichenberger P The Bacillus subtilis endospore: assembly and functions of the multilayered coat. Nature reviews. Microbiology. 2013 Jan; 11(1):33-44. doi:10.1038/nrmicro2921. PMID:23202530
Setlow P Dynamics of the assembly of a complex macromolecular structure--the coat of spores of the bacterium Bacillus subtilis. Molecular microbiology. 2012 Jan; 83(2):241-4. doi:10.1111/j.1365-2958.2011.07948.x. PMID:22192522
Buist G, Steen A, Kok J, Kuipers OP LysM, a widely distributed protein motif for binding to (peptido)glycans. Molecular microbiology. 2008 May; 68(4):838-47. doi:10.1111/j.1365-2958.2008.06211.x. PMID:18430080
Original Publications
Amon JD, Yadav AK, Ramirez-Guadiana FH, Meeske AJ, Cava F, Rudner DZ SwsB and SafA are required for CwlJ-dependent spore germination in . Journal of bacteriology. 2019 Dec 23; . pii:JB.00668-19. doi:10.1128/JB.00668-19. PMID:31871031
Fernandes CG, Martins D, Hernandez G, Sousa AL, Freitas C, Tranfield EM, Cordeiro TN, Serrano M, Moran CP, Henriques AO Temporal and spatial regulation of protein cross-linking by the pre-assembled substrates of a Bacillus subtilis spore coat transglutaminase. PLoS genetics. 2019 Apr 08; 15(4):e1007912. doi:10.1371/journal.pgen.1007912. PMID:30958830
Pereira FC, Nunes F, Cruz F, Fernandes C, Isidro AL, Lousa D, Soares CM, Moran CP, Henriques AO, Serrano M A LysM domain intervenes in sequential protein-protein and protein-peptidoglycan interactions important for spore coat assembly in . Journal of bacteriology. 2018 Nov 19; . pii:JB.00642-18. doi:10.1128/JB.00642-18. PMID:30455281
Nunes F, Fernandes C, Freitas C, Marini E, Serrano M, Moran CP, Eichenberger P, Henriques AO SpoVID functions as a non-competitive hub that connects the modules for assembly of the inner and outer spore coat layers in Bacillus subtilis. Molecular microbiology. 2018 Aug 31; . doi:10.1111/mmi.14116. PMID:30168214
Fernandes CG, Moran CP, Henriques AO Auto-regulation of SafA assembly through recruitment of a protein cross-linking enzyme. Journal of bacteriology. 2018 Apr 30; . pii:JB.00066-18. doi:10.1128/JB.00066-18. PMID:29712873
Nagler K, Setlow P, Reineke K, Driks A, Moeller R Involvement of Coat Proteins in Bacillus subtilis Spore Germination in High-Salinity Environments. Applied and environmental microbiology. 2015 Oct; 81(19):6725-35. doi:10.1128/AEM.01817-15. PMID:26187959
Plomp M, Carroll AM, Setlow P, Malkin AJ Architecture and assembly of the Bacillus subtilis spore coat. PloS one. 2014; 9(9):e108560. doi:10.1371/journal.pone.0108560. PMID:25259857
Watabe K [Overview of study on Bacillus subtilis spores]. Yakugaku zasshi : Journal of the Pharmaceutical Society of Japan. 2013; 133(7):783-97. . PMID:23811766
Qiao H, Krajcikova D, Liu C, Li Y, Wang H, Barak I, Tang J The interactions of spore-coat morphogenetic proteins studied by single-molecule recognition force spectroscopy. Chemistry, an Asian journal. 2012 Apr; 7(4):725-31. doi:10.1002/asia.201100795. PMID:22262582
McKenney PT, Eichenberger P Dynamics of spore coat morphogenesis in Bacillus subtilis. Molecular microbiology. 2012 Jan; 83(2):245-60. doi:10.1111/j.1365-2958.2011.07936.x. PMID:22171814
McKenney PT, Driks A, Eskandarian HA, Grabowski P, Guberman J, Wang KH, Gitai Z, Eichenberger P A distance-weighted interaction map reveals a previously uncharacterized layer of the Bacillus subtilis spore coat. Current biology : CB. 2010 May 25; 20(10):934-8. doi:10.1016/j.cub.2010.03.060. PMID:20451384
Costa T, Isidro AL, Moran CP, Henriques AO Interaction between coat morphogenetic proteins SafA and SpoVID. Journal of bacteriology. 2006 Nov; 188(22):7731-41. . PMID:16950916
Ozin AJ, Samford CS, Henriques AO, Moran CP SpoVID guides SafA to the spore coat in Bacillus subtilis. Journal of bacteriology. 2001 May; 183(10):3041-9. . PMID:11325931
Ozin AJ, Costa T, Henriques AO, Moran CP Alternative translation initiation produces a short form of a spore coat protein in Bacillus subtilis. Journal of bacteriology. 2001 Mar; 183(6):2032-40. . PMID:11222602
Ozin AJ, Henriques AO, Yi H, Moran CP Morphogenetic proteins SpoVID and SafA form a complex during assembly of the Bacillus subtilis spore coat. Journal of bacteriology. 2000 Apr; 182(7):1828-33. . PMID:10714986
Takamatsu H, Kodama T, Nakayama T, Watabe K Characterization of the yrbA gene of Bacillus subtilis, involved in resistance and germination of spores. Journal of bacteriology. 1999 Aug; 181(16):4986-94. . PMID:10438771

CEBEC9CECCF445C40D793E61A2CD23175631A473

Page visits: 4792

Time of last update: 2025-04-06 18:47:28

Author of last update: Jstuelk