frlO

frlO
168

aminosugar ABC transporter (binding protein)

Locus
BSU_32600
Molecular weight
47.86 kDa
Isoelectric point
5.67
Protein length
Gene length
Function
uptake of sugar amines
Product
aminosugar ABC transporter (binding protein)
Essential
no
Synonyms
frlO, yurO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1653 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,349,761  3,351,029
The protein
Protein family
Structure
3ZKK (PDB) (from Bifidobacterium animalis, 26% identity) PubMed
membrane associated (via FrlM-FrlN) PubMed
Expression and Regulation
Operons
Description
Regulation
'' FrlB'': repressed during growth in the presence of branched chain amino acids (CodY) PubMed
induced in the absence of RnpM PubMed
Regulatory mechanism
CodY: repression, PubMed, PubMed, in codY regulon
FrlR: repression, PubMed, in frlR regulon
RnpM: unknown, PubMed, in rnpM regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Additional information
the frlB-frlO-frlN-frlM-frlD-frlP operon is strongly downregulated in a cshA mutant PubMed
Open in new tab

frlBfrlP

2025-04-04 07:33:27

Jstuelk

129

1386d0b18bc93ba0b08e1c36531a0379aa199ac3

218EAE44649CE3CDE2633AF97E4CC56ABC5AA2E3

Biological materials
Mutant
MGNA-A561 (yurO::erm), available at the NBRP B. subtilis, Japan
BKE32600 (frlO::erm  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CAAAGGGTTGGCCTCCTCTG,  downstream forward: _UP4_TAAATCAAAGAAAAGGTGAA
BKK32600 (frlO::kan  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CAAAGGGTTGGCCTCCTCTG,  downstream forward: _UP4_TAAATCAAAGAAAAGGTGAA
References
Mahendran A, Orlando BJGenome wide structural prediction of ABC transporter systems in Bacillus subtilis.Frontiers in microbiology. 2024; 15:1469915. PMID: 39397791
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Ejby M, Fredslund F, Vujicic-Zagar A, Svensson B, Slotboom DJ, Abou Hachem M Structural basis for arabinoxylo-oligosaccharide capture by the probiotic Bifidobacterium animalis subsp. lactis Bl-04. Molecular microbiology. 2013 Dec; 90(5):1100-12. doi:10.1111/mmi.12419. PMID:24279727
Lehnik-Habrink M, Rempeters L, Kovács ÁT, Wrede C, Baierlein C, Krebber H, Kuipers OP, Stülke J DEAD-Box RNA helicases in Bacillus subtilis have multiple functions and act independently from each other. Journal of bacteriology. 2013 Feb; 195(3):534-44. doi:10.1128/JB.01475-12. PMID:23175651
Lehnik-Habrink M, Schaffer M, Mäder U, Diethmaier C, Herzberg C, Stülke J RNA processing in Bacillus subtilis: identification of targets of the essential RNase Y. Molecular microbiology. 2011 Sep; 81(6):1459-73. doi:10.1111/j.1365-2958.2011.07777.x. PMID:21815947
Deppe VM, Klatte S, Bongaerts J, Maurer KH, O'Connell T, Meinhardt F Genetic control of amadori product degradation in Bacillus subtilis via regulation of frlBONMD expression by FrlR. Applied and environmental microbiology. 2011 May; 77(9):2839-46. doi:10.1128/AEM.02515-10. PMID:21398478
Deppe VM, Bongaerts J, O'Connell T, Maurer KH, Meinhardt F Enzymatic deglycation of Amadori products in bacteria: mechanisms, occurrence and physiological functions. Applied microbiology and biotechnology. 2011 Apr; 90(2):399-406. doi:10.1007/s00253-010-3083-4. PMID:21347729
Hahne H, Wolff S, Hecker M, Becher D From complementarity to comprehensiveness--targeting the membrane proteome of growing Bacillus subtilis by divergent approaches. Proteomics. 2008 Oct; 8(19):4123-36. doi:10.1002/pmic.200800258. PMID:18763711
Molle V, Nakaura Y, Shivers RP, Yamaguchi H, Losick R, Fujita Y, Sonenshein AL Additional targets of the Bacillus subtilis global regulator CodY identified by chromatin immunoprecipitation and genome-wide transcript analysis. Journal of bacteriology. 2003 Mar; 185(6):1911-22. . PMID:12618455
Quentin Y, Fichant G, Denizot F Inventory, assembly and analysis of Bacillus subtilis ABC transport systems. Journal of molecular biology. 1999 Apr 02; 287(3):467-84. . PMID:10092453

9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B

Page visits: 4863

Time of last update: 2025-04-10 14:25:50

Author of last update: Jstuelk