gabR

gabR
168

transcription activator of gabT-gabD, repressor of gabR (MocR/ GabR family)

Locus
BSU_03890
Molecular weight
55.00 kDa
Isoelectric point
6.71
Protein length
479 aaSequenceBlast
Gene length
1440 bpSequenceBlast
Function
regulation of gamma-amino butyric acid utilization
Product
transcription regulator
Essential
no
Synonyms
gabR, ycnF
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

List of homologs in different organisms, belongs to COG1167 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, GabR regulon

Gene
Coordinates
440,025 → 441,464
The protein
Catalyzed reaction/ biological activity
transcription activation of the gabT-gabD operon in the presence  of GABA and PLP, transcription repression of gabR PubMed
Protein family
MocR/ GabR family PubMed
class-I pyridoxal-phosphate-dependent aminotransferase family (according to UniProt)
Domains
N-terminal DNA-binding helix-turn-helix motif (corresponding to domains of the GntR family) PubMed
C-terminal domain is homologous to PLP-binding large domain of aminotransferases PubMed
HTH gntR-type domain (aa 14-82) (according to UniProt)
Cofactors
gamma-aminobutyric acid, PLP PubMed
Structure
4MGR (PDB) (the apo-protein) PubMed
4N0B (PDB) (the complex with PLP) PubMed
P94426 (AlphaFold)
Effectors of protein activity
activation of ''gabT-gabD'' expression is triggered by gamma-amino butyrate and pyridoxalphosphate PubMed
in the absence of GABA, GabR represses gabT-gabD expression, whereas binding of GABA to GabR results in a conformational change resulting in activation of transcription PubMed
Expression and Regulation
Operons
Genes
gabR
Description
PubMed
Regulatory mechanism
GabR: negative autoregulation, PubMed, in gabR regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Open in new tab

gabR

2025-04-07 06:16:58

Jstuelk

88

c17c8cfd4239e1c6001df55dbca3fda04d57fc4d

506000345DBD8D9CB0D46D6A4930AD58E33B5DFD

Biological materials
Mutant
MGNA-C014 (ycnF::erm), available at the NBRP B. subtilis, Japan
BKE03890 (ΔgabR::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTTGTAGTTTCTCCTTC,  downstream forward: _UP4_AAAATCCCCGTTACAGGGGA
BKK03890 (ΔgabR::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTTGTAGTTTCTCCTTC,  downstream forward: _UP4_AAAATCCCCGTTACAGGGGA
Labs working on this gene/protein
Linc Sonenshein, Tufts University, Boston, MA, USA Homepage
References
Kaley NE, Liveris ZJ, Moore M, Reidl CT, Wawrzak Z, Becker DP, Liu DBioisosteric replacement of pyridoxal-5'-phosphate to pyridoxal-5'-tetrazole targeting Bacillus subtilis GabR.Protein science : a publication of the Protein Society. 2025 Jan; 34(1):e70014. PMID: 39720892
Lebovich M, Andrews LBSurveying the Genetic Design Space for Transcription Factor-Based Metabolite Biosensors: Synthetic Gamma-Aminobutyric Acid and Propionate Biosensors in E. coli Nissle 1917.Frontiers in bioengineering and biotechnology. 2022; 10:938056. PMID: 36091463
Frezzini M, Narzi D, Sciolari AM, Guidoni L, Pascarella S Molecular dynamics of an asymmetric form of GabR, a bacterial transcriptional regulator. Biophysical chemistry. 2020 Jul; 262:106380. pii:S0301-4622(20)30088-0. doi:10.1016/j.bpc.2020.106380. PMID:32413777
Nardella C, Barile A, di Salvo ML, Milano T, Pascarella S, Tramonti A, Contestabile R Interaction of Bacillus subtilis GabR with the gabTD promoter: role of repeated sequences and effect of GABA in transcriptional activation. The FEBS journal. 2020 Mar 09; . doi:10.1111/febs.15286. PMID:32147931
Frezzini M, Guidoni L, Pascarella S Conformational transitions induced by γ-amino butyrate binding in GabR, a bacterial transcriptional regulator. Scientific reports. 2019 Dec 17; 9(1):19319. doi:10.1038/s41598-019-55581-1. PMID:31848410
Milano T, Gulzar A, Narzi D, Guidoni L, Pascarella S Molecular dynamics simulation unveils the conformational flexibility of the interdomain linker in the bacterial transcriptional regulator GabR from Bacillus subtilis bound to pyridoxal 5'-phosphate. PloS one. 2017; 12(12):e0189270. doi:10.1371/journal.pone.0189270. PMID:29253008
Park SA, Park YS, Lee KS Crystal structure of the C-terminal domain of Bacillus subtilis GabR reveals a closed conformation by γ-aminobutyric acid binding, inducing transcriptional activation. Biochemical and biophysical research communications. 2017 Apr 12; . pii:S0006-291X(17)30718-0. doi:10.1016/j.bbrc.2017.04.052. PMID:28412355
Wu R, Sanishvili R, Belitsky BR, Juncosa JI, Le HV, Lehrer HJ, Farley M, Silverman RB, Petsko GA, Ringe D, Liu D PLP and GABA trigger GabR-mediated transcription regulation in Bacillus subtilis via external aldimine formation. Proceedings of the National Academy of Sciences of the United States of America. 2017 Mar 27; . pii:201703019. doi:10.1073/pnas.1703019114. PMID:28348215
Amidani D, Tramonti A, Canosa AV, Campanini B, Maggi S, Milano T, di Salvo ML, Pascarella S, Contestabile R, Bettati S, Rivetti C Study of DNA binding and bending by Bacillus subtilis GabR, a PLP-dependent transcription factor. Biochimica et biophysica acta. 2017 Jan; 1861(1 Pt A):3474-3489. pii:S0304-4165(16)30349-X. doi:10.1016/j.bbagen.2016.09.013. PMID:27640111
Al-Zyoud WA, Hynson RM, Ganuelas LA, Coster AC, Duff AP, Baker MA, Stewart AG, Giannoulatou E, Ho JW, Gaus K, Liu D, Lee LK, Böcking T Binding of transcription factor GabR to DNA requires recognition of DNA shape at a location distinct from its cognate binding site. Nucleic acids research. 2016 Feb 18; 44(3):1411-20. doi:10.1093/nar/gkv1466. PMID:26681693
Okuda K, Ito T, Goto M, Takenaka T, Hemmi H, Yoshimura T Domain characterization of Bacillus subtilis GabR, a pyridoxal 5'-phosphate-dependent transcriptional regulator. Journal of biochemistry. 2015 Sep; 158(3):225-34. doi:10.1093/jb/mvv040. PMID:25911692
Okuda K, Kato S, Ito T, Shiraki S, Kawase Y, Goto M, Kawashima S, Hemmi H, Fukada H, Yoshimura T Role of the aminotransferase domain in Bacillus subtilis GabR, a pyridoxal 5'-phosphate-dependent transcriptional regulator. Molecular microbiology. 2015 Jan; 95(2):245-57. doi:10.1111/mmi.12861. PMID:25388514
Edayathumangalam R, Wu R, Garcia R, Wang Y, Wang W, Kreinbring CA, Bach A, Liao J, Stone TA, Terwilliger TC, Hoang QQ, Belitsky BR, Petsko GA, Ringe D, Liu D Crystal structure of Bacillus subtilis GabR, an autorepressor and transcriptional activator of gabT. Proceedings of the National Academy of Sciences of the United States of America. 2013 Oct 29; 110(44):17820-5. doi:10.1073/pnas.1315887110. PMID:24127574
Bramucci E, Milano T, Pascarella S Genomic distribution and heterogeneity of MocR-like transcriptional factors containing a domain belonging to the superfamily of the pyridoxal-5'-phosphate dependent enzymes of fold type I. Biochemical and biophysical research communications. 2011 Nov 11; 415(1):88-93. doi:10.1016/j.bbrc.2011.10.017. PMID:22020104
Belitsky BR Bacillus subtilis GabR, a protein with DNA-binding and aminotransferase domains, is a PLP-dependent transcriptional regulator. Journal of molecular biology. 2004 Jul 16; 340(4):655-64. . PMID:15223311
Belitsky BR, Sonenshein AL GabR, a member of a novel protein family, regulates the utilization of gamma-aminobutyrate in Bacillus subtilis. Molecular microbiology. 2002 Jul; 45(2):569-83. . PMID:12123465
Rigali S, Derouaux A, Giannotta F, Dusart J Subdivision of the helix-turn-helix GntR family of bacterial regulators in the FadR, HutC, MocR, and YtrA subfamilies. The Journal of biological chemistry. 2002 Apr 12; 277(15):12507-15. . PMID:11756427

C7C36FAC0CE72226960FC7E8E016B8EC77AF1036

Page visits: 7474

Time of last update: 2025-04-07 08:26:15

Author of last update: Jstuelk