tapA

tapA
168

primer for TasA oligomerization

Locus
BSU_24640
Molecular weight
28.92 kDa
Isoelectric point
6.68
Protein length
253 aaSequenceBlast
Gene length
762 bpSequenceBlast
Function
biofilm formation
Product
primer for TasA oligomerization
Essential
no
Synonyms
tapA, yqhD, yqxM
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,554,486  2,555,247
Phenotypes of a mutant
no biofilm formation PubMed
The protein
Catalyzed reaction/ biological activity
binds TasA to initiate TasA oligomerization PubMed
Structure
6HQC (PDB) (aa 75 ... 190) PubMed
6QAY (PDB) (NMR structure) PubMed
8AIF (PDB) (aa 71 ... 190) PubMed
P40949 (AlphaFold)
Localization
attached to the cell surface (on the outside of the cell), associated with peptidoglycan  PubMed
secretion requires SipW PubMed
Expression and Regulation
Operons
Genes
tapA-sipW-tasA
Description
PubMed
Regulation
repressed by casamino acids PubMed
Regulatory mechanism
AbrB: repression, PubMed, in abrB regulon
SinR: repression, PubMed, in sinR regulon
RemA: activation, PubMed, in remA regulon
LutR: activation, PubMed, in lutR regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Additional information
induction by sequestration of SinR by SinI or SlrA PubMed or by SlrR PubMed
expression of the operon is localized to a ring near the periphery of the biofilm PubMed
Open in new tab

tapA→tasA

2025-04-05 17:22:14

Jstuelk

153

5d4b2839ae781570552ba6a28b48e7489d628dd2

25F0FAE210D5101B1935E4625742633C173FC509

Biological materials
Mutant
MGNA-C429 (yqhD::erm), available at the NBRP B. subtilis, Japan
BKE24640 (tapA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATCTTACCTCCTGTAAA,  downstream forward: _UP4_AGCAATGAAGCTGATCAGTA
BKK24640 (tapA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATCTTACCTCCTGTAAA,  downstream forward: _UP4_AGCAATGAAGCTGATCAGTA
LacZ fusion
pGP1926 (in pAC6), available in Jörg Stülke's lab
References
Reviews
Arnaouteli S, Bamford NC, Stanley-Wall NR, Kovács ÁTBacillus subtilis biofilm formation and social interactions.Nature reviews. Microbiology. 2021 Apr 6; . PMID: 33824496
Hobley L, Harkins C, MacPhee CE, Stanley-Wall NR Giving structure to the biofilm matrix: an overview of individual strategies and emerging common themes. FEMS microbiology reviews. 2015 Sep; 39(5):649-69. doi:10.1093/femsre/fuv015. PMID:25907113
Driks A Tapping into the biofilm: insights into assembly and disassembly of a novel amyloid fibre in Bacillus subtilis. Molecular microbiology. 2011 Jun; 80(5):1133-6. doi:10.1111/j.1365-2958.2011.07666.x. PMID:21488983
Original Publications
Yannarell SM, Beaudoin ES, Talley HS, Schoenborn AA, Orr G, Anderton CR, Chrisler WB, Shank EAExtensive cellular multi-tasking within Bacillus subtilis biofilms.mSystems. 2023 Aug 1; :e0089122. PMID: 37527273
Roske Y, Lindemann F, Diehl A, Cremer N, Higman VA, Schlegel B, Leidert M, Driller K, Turgay K, Schmieder P, Heinemann U, Oschkinat HTapA acts as specific chaperone in TasA filament formation by strand complementation.Proceedings of the National Academy of Sciences of the United States of America. 2023 Apr 25; 120(17):e2217070120. PMID: 37068239
Verma N, Srivastava S, Malik R, Yadav JK, Goyal P, Pandey JComputational investigation for modeling the protein-protein interaction of TasA(28-261)-TapA(33-253): a decisive process in biofilm formation by Bacillus subtilis.Journal of molecular modeling. 2020 Aug 10; 26(9):226. PMID: 32779018
Earl C, Arnaouteli S, Bamford NC, Porter M, Sukhodub T, MacPhee CE, Stanley-Wall NRThe majority of the matrix protein TapA is dispensable for Bacillus subtilis colony biofilm architecture.Molecular microbiology. 2020 Jun 3; . PMID: 32491277
Chai L, Abbasi R, Mousa R, Dekel N, Amartely H, Danieli T, Lebendiker M, Levi-Kalisman Y, Shalev DE, Metanis N The bacterial extracellular matrix protein TapA is a two-domain partially disordered protein. Chembiochem : a European journal of chemical biology. 2018 Oct 29; . doi:10.1002/cbic.201800634. PMID:30371005
Srinivasan S, Vladescu ID, Koehler SA, Wang X, Mani M, Rubinstein SM Matrix Production and Sporulation in Bacillus subtilis Biofilms Localize to Propagating Wave Fronts. Biophysical journal. 2018 Mar 27; 114(6):1490-1498. pii:S0006-3495(18)30197-8. doi:10.1016/j.bpj.2018.02.002. PMID:29590605
Ogura M Post-transcriptionally generated cell heterogeneity regulates biofilm formation in Bacillus subtilis. Genes to cells : devoted to molecular & cellular mechanisms. 2016 Apr; 21(4):335-49. doi:10.1111/gtc.12343. PMID:26819068
van Gestel J, Vlamakis H, Kolter R From cell differentiation to cell collectives: Bacillus subtilis uses division of labor to migrate. PLoS biology. 2015 Apr; 13(4):e1002141. doi:10.1371/journal.pbio.1002141. PMID:25894589
Romero D, Vlamakis H, Losick R, Kolter R Functional analysis of the accessory protein TapA in Bacillus subtilis amyloid fiber assembly. Journal of bacteriology. 2014 Apr; 196(8):1505-13. doi:10.1128/JB.01363-13. PMID:24488317
Winkelman JT, Bree AC, Bate AR, Eichenberger P, Gourse RL, Kearns DB RemA is a DNA-binding protein that activates biofilm matrix gene expression in Bacillus subtilis. Molecular microbiology. 2013 Jun; 88(5):984-97. doi:10.1111/mmi.12235. PMID:23646920
Diethmaier C, Pietack N, Gunka K, Wrede C, Lehnik-Habrink M, Herzberg C, Hübner S, Stülke J A novel factor controlling bistability in Bacillus subtilis: the YmdB protein affects flagellin expression and biofilm formation. Journal of bacteriology. 2011 Nov; 193(21):5997-6007. doi:10.1128/JB.05360-11. PMID:21856853
Lehnik-Habrink M, Schaffer M, Mäder U, Diethmaier C, Herzberg C, Stülke J RNA processing in Bacillus subtilis: identification of targets of the essential RNase Y. Molecular microbiology. 2011 Sep; 81(6):1459-73. doi:10.1111/j.1365-2958.2011.07777.x. PMID:21815947
Romero D, Vlamakis H, Losick R, Kolter R An accessory protein required for anchoring and assembly of amyloid fibres in B. subtilis biofilms. Molecular microbiology. 2011 Jun; 80(5):1155-68. doi:10.1111/j.1365-2958.2011.07653.x. PMID:21477127
Kolodkin-Gal I, Romero D, Cao S, Clardy J, Kolter R, Losick R D-amino acids trigger biofilm disassembly. Science (New York, N.Y.). 2010 Apr 30; 328(5978):627-9. doi:10.1126/science.1188628. PMID:20431016
Chai Y, Norman T, Kolter R, Losick R An epigenetic switch governing daughter cell separation in Bacillus subtilis. Genes & development. 2010 Apr 15; 24(8):754-65. doi:10.1101/gad.1915010. PMID:20351052
López D, Vlamakis H, Losick R, Kolter R Paracrine signaling in a bacterium. Genes & development. 2009 Jul 15; 23(14):1631-8. doi:10.1101/gad.1813709. PMID:19605685
Kobayashi K SlrR/SlrA controls the initiation of biofilm formation in Bacillus subtilis. Molecular microbiology. 2008 Sep; 69(6):1399-410. doi:10.1111/j.1365-2958.2008.06369.x. PMID:18647168
Chu F, Kearns DB, McLoon A, Chai Y, Kolter R, Losick R A novel regulatory protein governing biofilm formation in Bacillus subtilis. Molecular microbiology. 2008 Jun; 68(5):1117-27. doi:10.1111/j.1365-2958.2008.06201.x. PMID:18430133
Chai Y, Chu F, Kolter R, Losick R Bistability and biofilm formation in Bacillus subtilis. Molecular microbiology. 2008 Jan; 67(2):254-63. . PMID:18047568
Strauch MA, Bobay BG, Cavanagh J, Yao F, Wilson A, Le Breton Y Abh and AbrB control of Bacillus subtilis antimicrobial gene expression. Journal of bacteriology. 2007 Nov; 189(21):7720-32. . PMID:17720793
Chu F, Kearns DB, Branda SS, Kolter R, Losick R Targets of the master regulator of biofilm formation in Bacillus subtilis. Molecular microbiology. 2006 Feb; 59(4):1216-28. . PMID:16430695
Stöver AG, Driks A Control of synthesis and secretion of the Bacillus subtilis protein YqxM. Journal of bacteriology. 1999 Nov; 181(22):7065-9. . PMID:10559173
Stöver AG, Driks A Regulation of synthesis of the Bacillus subtilis transition-phase, spore-associated antibacterial protein TasA. Journal of bacteriology. 1999 Sep; 181(17):5476-81. . PMID:10464223

8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3

Page visits: 9360

Time of last update: 2025-04-07 03:27:50

Author of last update: Jstuelk