abrB
168

transcriptional regulator of transition state genes

Locus

BSU_00370

Molecular weight

10.63 kDa

Isoelectric point

6.57

Protein length

96 aaSequenceBlast

Gene length

291 bpSequenceBlast

Function

regulation of gene expression during the transition from growth to stationary phase

Product

transcriptional regulator

Essential

Synonyms

abrB, cpsX, tolB

Outlinks

BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Regulation of gene expression, Transition state regulators

Groups of genes, Phosphoproteins, Phosphorylation on a Ser residue

List of homologs in different organisms, belongs to COG2002 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, Spo0A regulon, AbrB regulon

Gene

Coordinates

44,848 → 45,138

Phenotypes of a mutant

No swarming motility on B medium PubMed

The protein

Domains

SpoVT-AbrB domain (aa 7-52) (according to UniProt)

Structure

2MJG (PDB) (full-length protein) PubMed

1Z0R (PDB) (N-terminal DNA recognition domain) PubMed

P08874 (AlphaFold)

Modification

phosphorylated on Ser-86 PubMed by PrkC, PrkD, and YabT results in loss of DNA-binding activity PubMed

Effectors of protein activity

interaction with AbbA results in inactivation of AbrB PubMed

Paralogous protein(s)

SpoVT, Abh

Expression and Regulation

Operons

Genes

abrB

Description

PubMed

Regulation

expressed at the onset of stationary phase PubMed

Regulatory mechanism

Spo0A: repression, -P PubMed, in spo0A regulon

AbrB: repression, PubMed, in abrB regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Additional information

degradation of the ''abrB'' mRNA is triggered by base-pairing with RnaC PubMed

Open in new tab

Biological materials

Mutant

TT731 (aphA3)

1A935 (abrB::cat), PubMed, available at BGSC

GP1548 (abrB::ermC), available in Stülke lab

BKE00370 (ΔabrB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCTCCTCCCAAGAGATA, downstream forward: _UP4_TAATCATTTCTTGTACAAAA

BKK00370 (ΔabrB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCTCCTCCCAAGAGATA, downstream forward: _UP4_TAATCATTTCTTGTACAAAA

Two-hybrid system

B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Stülke lab

Labs working on this gene/protein

Richard Losick, Harvard Univ., Cambridge, USA homepage

Mark Strauch, Baltimore, USA homepage

References

Reviews

Hoch JA A Life in Bacillus subtilis Signal Transduction. Annual review of microbiology. 2017 Sep 08; 71:1-19. doi:10.1146/annurev-micro-030117-020355. PMID:28886686

Schultz D, Wolynes PG, Ben Jacob E, Onuchic JN Deciding fate in adverse times: sporulation and competence in Bacillus subtilis. Proceedings of the National Academy of Sciences of the United States of America. 2009 Dec 15; 106(50):21027-34. doi:10.1073/pnas.0912185106. PMID:19995980

Hamze K, Julkowska D, Autret S, Hinc K, Nagorska K, Sekowska A, Holland IB, Séror SJ Identification of genes required for different stages of dendritic swarming in Bacillus subtilis, with a novel role for phrC. Microbiology (Reading, England). 2009 Feb; 155(Pt 2):398-412. doi:10.1099/mic.0.021477-0. PMID:19202088

Nagórska K, Hinc K, Strauch MA, Obuchowski M Influence of the sigmaB stress factor and yxaB, the gene for a putative exopolysaccharide synthase under sigmaB Control, on biofilm formation. Journal of bacteriology. 2008 May; 190(10):3546-56. doi:10.1128/JB.01665-07. PMID:18326573

Phillips ZE, Strauch MA Bacillus subtilis sporulation and stationary phase gene expression. Cellular and molecular life sciences : CMLS. 2002 Mar; 59(3):392-402. . PMID:11964117

Klein W, Marahiel MA Structure-function relationship and regulation of two Bacillus subtilis DNA-binding proteins, HBsu and AbrB. Journal of molecular microbiology and biotechnology. 2002 May; 4(3):323-9. . PMID:11931565

Original Publications

Fernandez NL, Simmons LATwo distinct regulatory systems control pulcherrimin biosynthesis in Bacillus subtilis.PLoS genetics. 2024 May 16; 20(5):e1011283. PMID: 38753885

O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589

Tolibia SEM, Pacheco AD, Balbuena SYG, Rocha J, López Y López VEEngineering of global transcription factors in Bacillus, a genetic tool for increasing product yields: a bioprocess overview.World journal of microbiology & biotechnology. 2022 Nov 14; 39(1):12. PMID: 36372802

Yamamoto J, Chumsakul O, Toya Y, Morimoto T, Liu S, Masuda K, Kageyama Y, Hirasawa T, Matsuda F, Ogasawara N, Shimizu H, Yoshida KI, Oshima T, Ishikawa SConstitutive expression of the global regulator AbrB restores the growth defect of a genome-reduced Bacillus subtilis strain and improves its metabolite production.DNA research : an international journal for rapid publication of reports on genes and genomes. 2022 May 27; 29(3). PMID: 35608323

Zhang Q, Kobras CM, Gebhard S, Mascher T, Wolf DRegulation of heterologous subtilin production in Bacillus subtilis W168.Microbial cell factories. 2022 Apr 7; 21(1):57. PMID: 35392905

Klausmann P, Lilge L, Aschern M, Hennemann K, Henkel M, Hausmann R, Morabbi Heravi KInfluence of B. subtilis 3NA mutations in spo0A and abrB on surfactin production in B. subtilis 168.Microbial cell factories. 2021 Sep 26; 20(1):188. PMID: 34565366

de Jong L, Roseboom W, Kramer G A composite filter for low FDR of protein-protein interactions detected by in vivo cross-linking. Journal of proteomics. 2021 Jan 6; 230:103987. PMID: 32949815

Stein T Oxygen-Limiting Growth Conditions and Deletion of the Transition State Regulator Protein Abrb in Bacillus subtilis 6633 Result in an Increase in Subtilosin Production and a Decrease in Subtilin Production. Probiotics and antimicrobial proteins. 2019 Apr 13; . doi:10.1007/s12602-019-09547-4. PMID:30980290

Denham EL, Piersma S, Rinket M, Reilman E, de Goffau MC, van Dijl JM Differential expression of a prophage-encoded glycocin and its immunity protein suggests a mutualistic strategy of a phage and its host. Scientific reports. 2019 Feb 26; 9(1):2845. doi:10.1038/s41598-019-39169-3. PMID:30808982

Rösch TC, Oviedo-Bocanegra LM, Fritz G, Graumann PL SMTracker: a tool for quantitative analysis, exploration and visualization of single-molecule tracking data reveals highly dynamic binding of B. subtilis global repressor AbrB throughout the genome. Scientific reports. 2018 Oct 24; 8(1):15747. doi:10.1038/s41598-018-33842-9. PMID:30356068

Mars RA, Nicolas P, Ciccolini M, Reilman E, Reder A, Schaffer M, Mäder U, Völker U, van Dijl JM, Denham EL Small regulatory RNA-induced growth rate heterogeneity of Bacillus subtilis. PLoS genetics. 2015 Mar; 11(3):e1005046. doi:10.1371/journal.pgen.1005046. PMID:25790031

Bochmann SM, Spieß T, Kötter P, Entian KD Synthesis and succinylation of subtilin-like lantibiotics are strongly influenced by glucose and transition state regulator AbrB. Applied and environmental microbiology. 2015 Jan; 81(2):614-22. doi:10.1128/AEM.02579-14. PMID:25381239

Olson AL, Tucker AT, Bobay BG, Soderblom EJ, Moseley MA, Thompson RJ, Cavanagh J Structure and DNA-binding traits of the transition state regulator AbrB. Structure (London, England : 1993). 2014 Nov 04; 22(11):1650-6. doi:10.1016/j.str.2014.08.018. pii:S0969-2126(14)00282-2. PMID:25308864

Lozano Goné AM, Dinorín Téllez Girón J, Jiménez Montejo FE, Hidalgo-Lara ME, López Y López VE Behavior of transition state regulator AbrB in batch cultures of Bacillus thuringiensis. Current microbiology. 2014 Nov; 69(5):725-32. doi:10.1007/s00284-014-0650-4. PMID:25002359

Neubauer S, Dolgova O, Präg G, Borriss R, Makarewicz O Substitutional analysis of the C-terminal domain of AbrB revealed its essential role in DNA-binding activity. PloS one. 2014; 9(5):e97254. doi:10.1371/journal.pone.0097254. PMID:24832089

Kobir A, Poncet S, Bidnenko V, Delumeau O, Jers C, Zouhir S, Grenha R, Nessler S, Noirot P, Mijakovic I Phosphorylation of Bacillus subtilis gene regulator AbrB modulates its DNA-binding properties. Molecular microbiology. 2014 Jun; 92(5):1129-41. doi:10.1111/mmi.12617. PMID:24731262

Tucker AT, Bobay BG, Banse AV, Olson AL, Soderblom EJ, Moseley MA, Thompson RJ, Varney KM, Losick R, Cavanagh J A DNA mimic: the structure and mechanism of action for the anti-repressor protein AbbA. Journal of molecular biology. 2014 May 01; 426(9):1911-24. doi:10.1016/j.jmb.2014.02.010. pii:S0022-2836(14)00077-1. PMID:24534728

Soufi B, Kumar C, Gnad F, Mann M, Mijakovic I, Macek B Stable isotope labeling by amino acids in cell culture (SILAC) applied to quantitative proteomics of Bacillus subtilis. Journal of proteome research. 2010 Jul 02; 9(7):3638-46. doi:10.1021/pr100150w. PMID:20509597

Seredick SD, Seredick BM, Baker D, Spiegelman GB An A257V mutation in the bacillus subtilis response regulator Spo0A prevents regulated expression of promoters with low-consensus binding sites. Journal of bacteriology. 2009 Sep; 191(17):5489-98. doi:10.1128/JB.00590-09. PMID:19581368

Luo Y, Helmann JD Extracytoplasmic function sigma factors with overlapping promoter specificity regulate sublancin production in Bacillus subtilis. Journal of bacteriology. 2009 Aug; 191(15):4951-8. doi:10.1128/JB.00549-09. PMID:19465659

Chu F, Kearns DB, McLoon A, Chai Y, Kolter R, Losick R A novel regulatory protein governing biofilm formation in Bacillus subtilis. Molecular microbiology. 2008 Jun; 68(5):1117-27. doi:10.1111/j.1365-2958.2008.06201.x. PMID:18430133

Strauch MA, Bobay BG, Cavanagh J, Yao F, Wilson A, Le Breton Y Abh and AbrB control of Bacillus subtilis antimicrobial gene expression. Journal of bacteriology. 2007 Nov; 189(21):7720-32. . PMID:17720793

Jordan S, Rietkötter E, Strauch MA, Kalamorz F, Butcher BG, Helmann JD, Mascher T LiaRS-dependent gene expression is embedded in transition state regulation in Bacillus subtilis. Microbiology (Reading, England). 2007 Aug; 153(Pt 8):2530-40. . PMID:17660417

Bobay BG, Mueller GA, Thompson RJ, Murzin AG, Venters RA, Strauch MA, Cavanagh J NMR structure of AbhN and comparison with AbrBN: FIRST insights into the DNA binding promiscuity and specificity of AbrB-like transition state regulator proteins. The Journal of biological chemistry. 2006 Jul 28; 281(30):21399-409. . PMID:16702211

Bobay BG, Andreeva A, Mueller GA, Cavanagh J, Murzin AG Revised structure of the AbrB N-terminal domain unifies a diverse superfamily of putative DNA-binding proteins. FEBS letters. 2005 Oct 24; 579(25):5669-74. . PMID:16223496

Yao F, Strauch MA Independent and interchangeable multimerization domains of the AbrB, Abh, and SpoVT global regulatory proteins. Journal of bacteriology. 2005 Sep; 187(18):6354-62. . PMID:16159768

Fujita M, González-Pastor JE, Losick R High- and low-threshold genes in the Spo0A regulon of Bacillus subtilis. Journal of bacteriology. 2005 Feb; 187(4):1357-68. . PMID:15687200

Bobay BG, Benson L, Naylor S, Feeney B, Clark AC, Goshe MB, Strauch MA, Thompson R, Cavanagh J Evaluation of the DNA binding tendencies of the transition state regulator AbrB. Biochemistry. 2004 Dec 28; 43(51):16106-18. . PMID:15610005

Hamon MA, Stanley NR, Britton RA, Grossman AD, Lazazzera BA Identification of AbrB-regulated genes involved in biofilm formation by Bacillus subtilis. Molecular microbiology. 2004 May; 52(3):847-60. . PMID:15101989

Kim HJ, Kim SI, Ratnayake-Lecamwasam M, Tachikawa K, Sonenshein AL, Strauch M Complex regulation of the Bacillus subtilis aconitase gene. Journal of bacteriology. 2003 Mar; 185(5):1672-80. . PMID:12591885

Hamoen LW, Kausche D, Marahiel MA, van Sinderen D, Venema G, Serror P The Bacillus subtilis transition state regulator AbrB binds to the -35 promoter region of comK. FEMS microbiology letters. 2003 Jan 28; 218(2):299-304. . PMID:12586407

Benson LM, Vaughn JL, Strauch MA, Bobay BG, Thompson R, Naylor S, Cavanagh J Macromolecular assembly of the transition state regulator AbrB in its unbound and complexed states probed by microelectrospray ionization mass spectrometry. Analytical biochemistry. 2002 Jul 15; 306(2):222-7. . PMID:12123659

Qian Q, Lee CY, Helmann JD, Strauch MA AbrB is a regulator of the sigma(W) regulon in Bacillus subtilis. FEMS microbiology letters. 2002 Jun 04; 211(2):219-23. . PMID:12076816

Shafikhani SH, Mandic-Mulec I, Strauch MA, Smith I, Leighton T Postexponential regulation of sin operon expression in Bacillus subtilis. Journal of bacteriology. 2002 Jan; 184(2):564-71. . PMID:11751836

Phillips ZE, Strauch MA Role of Cys54 in AbrB multimerization and DNA-binding activity. FEMS microbiology letters. 2001 Sep 25; 203(2):207-10. . PMID:11583849

Xu K, Strauch MA DNA-binding activity of amino-terminal domains of the Bacillus subtilis AbrB protein. Journal of bacteriology. 2001 Jul; 183(13):4094-8. . PMID:11395475

Gustafsson MC, von Wachenfeldt C A novel diffusible substance can overcome the apparent AbrB repression of the Bacillus subtilis fatR promoter. FEMS microbiology letters. 2001 May 30; 199(2):197-202. . PMID:11377867

Vaughn JL, Feher V, Naylor S, Strauch MA, Cavanagh J Novel DNA binding domain and genetic regulation model of Bacillus subtilis transition state regulator abrB. Nature structural biology. 2000 Dec; 7(12):1139-46. . PMID:11101897

Hahn J, Luttinger A, Dubnau D Regulatory inputs for the synthesis of ComK, the competence transcription factor of Bacillus subtilis. Molecular microbiology. 1996 Aug; 21(4):763-75. . PMID:8878039

Xu K, Strauch MA In vitro selection of optimal AbrB-binding sites: comparison to known in vivo sites indicates flexibility in AbrB binding and recognition of three-dimensional DNA structures. Molecular microbiology. 1996 Jan; 19(1):145-58. . PMID:8821944

Xu K, Clark D, Strauch MA Analysis of abrB mutations, mutant proteins, and why abrB does not utilize a perfect consensus in the -35 region of its sigma A promoter. The Journal of biological chemistry. 1996 Feb 02; 271(5):2621-6. . PMID:8576231

Hahn J, Roggiani M, Dubnau D The major role of Spo0A in genetic competence is to downregulate abrB, an essential competence gene. Journal of bacteriology. 1995 Jun; 177(12):3601-5. . PMID:7768874

Strauch MA AbrB modulates expression and catabolite repression of a Bacillus subtilis ribose transport operon. Journal of bacteriology. 1995 Dec; 177(23):6727-31. . PMID:7592460

Perego M, Spiegelman GB, Hoch JA Structure of the gene for the transition state regulator, abrB: regulator synthesis is controlled by the spo0A sporulation gene in Bacillus subtilis. Molecular microbiology. 1988 Nov; 2(6):689-99. . PMID:3145384

Robertson JB, Gocht M, Marahiel MA, Zuber P AbrB, a regulator of gene expression in Bacillus, interacts with the transcription initiation regions of a sporulation gene and an antibiotic biosynthesis gene. Proceedings of the National Academy of Sciences of the United States of America. 1989 Nov; 86(21):8457-61. . PMID:2554317

Strauch MA, Perego M, Burbulys D, Hoch JA The transition state transcription regulator AbrB of Bacillus subtilis is autoregulated during vegetative growth. Molecular microbiology. 1989 Sep; 3(9):1203-9. . PMID:2507867

Strauch MA, Spiegelman GB, Perego M, Johnson WC, Burbulys D, Hoch JA The transition state transcription regulator abrB of Bacillus subtilis is a DNA binding protein. The EMBO journal. 1989 May; 8(5):1615-21. . PMID:2504584

Zuber P, Losick R Role of AbrB in Spo0A- and Spo0B-dependent utilization of a sporulation promoter in Bacillus subtilis. Journal of bacteriology. 1987 May; 169(5):2223-30. . PMID:2437099

Strauch M, Webb V, Spiegelman G, Hoch JA The SpoOA protein of Bacillus subtilis is a repressor of the abrB gene. Proceedings of the National Academy of Sciences of the United States of America. 1990 Mar; 87(5):1801-5. . PMID:2106683

Fürbass R, Marahiel MA Mutant analysis of interaction of the Bacillus subtilis transcription regulator AbrB with the antibiotic biosynthesis gene tycA. FEBS letters. 1991 Aug 05; 287(1-2):153-6. . PMID:1908787

Fürbass R, Gocht M, Zuber P, Marahiel MA Interaction of AbrB, a transcriptional regulator from Bacillus subtilis with the promoters of the transition state-activated genes tycA and spoVG. Molecular & general genetics : MGG. 1991 Mar; 225(3):347-54. . PMID:1850083

Slack FJ, Mueller JP, Strauch MA, Mathiopoulos C, Sonenshein AL Transcriptional regulation of a Bacillus subtilis dipeptide transport operon. Molecular microbiology. 1991 Aug; 5(8):1915-25. . PMID:1766371

The AbrB regulon

Chumsakul O, Nakamura K, Kurata T, Sakamoto T, Hobman JL, Ogasawara N, Oshima T, Ishikawa S High-resolution mapping of in vivo genomic transcription factor binding sites using in situ DNase I footprinting and ChIP-seq. DNA research : an international journal for rapid publication of reports on genes and genomes. 2013 Aug; 20(4):325-38. doi:10.1093/dnares/dst013. PMID:23580539

Chumsakul O, Takahashi H, Oshima T, Hishimoto T, Kanaya S, Ogasawara N, Ishikawa S Genome-wide binding profiles of the Bacillus subtilis transition state regulator AbrB and its homolog Abh reveals their interactive role in transcriptional regulation. Nucleic acids research. 2011 Jan; 39(2):414-28. doi:10.1093/nar/gkq780. PMID:20817675

Banse AV, Chastanet A, Rahn-Lee L, Hobbs EC, Losick R Parallel pathways of repression and antirepression governing the transition to stationary phase in Bacillus subtilis. Proceedings of the National Academy of Sciences of the United States of America. 2008 Oct 07; 105(40):15547-52. doi:10.1073/pnas.0805203105. PMID:18840696

Page visits: 22776

Time of last update: 2025-04-07 11:00:19

Author of last update: Jstuelk

abrB 168

abrB
168