tnrA

tnrA
168

transcriptional pleiotropic regulator (MerR family) involved in global nitrogen regulation

Locus
BSU_13310
Molecular weight
12.99 kDa
Isoelectric point
10.23
Protein length
110 aaSequenceBlast
Gene length
333 bpSequenceBlast
Function
regulation of nitrogen assimilation
Product
transcription activator/ repressor (MerR family)
Essential
no
Synonyms
tnrA, scgR
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0789 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,397,411  1,397,743
The protein
Protein family
MerR family
Domains
HTH merR-type domain (aa 13-81) (according to UniProt)
Structure
4R22 (PDB) (the TnrA-DNA complex) PubMed
4S0R (PDB) (the GlnA-TnrA complex) PubMed
Q45666 (AlphaFold)
Effectors of protein activity
feedback-inhibited GlnA prevents TnrA from DNA binding
Localization
membrane-associated via NrgA-NrgB under conditions of poor nitrogen supply PubMed
Expression and Regulation
Operons
Genes
tnrA
Description
PubMed
Regulation
expressed in the absence of good nitrogen sources (glutamine or ammonium) (TnrA) PubMed
Regulatory mechanism
TnrA: activation, PubMed, in tnrA regulon
GlnR: repression, in glnR regulon
Open in new tab

tnrA

2025-04-04 08:07:19

Jstuelk

82

1fb2ce88d9aeaae5edf8bdef96072b105a1a59ed

B48C1C7315DDF40852E7BFA2FD194A721B258FA1

Biological materials
Mutant
GP252 (in frame deletion), available in Jörg Stülke's lab
BKE13310 (tnrA::ermC) (available at the BGSC and in Jörg Stülke's lab) PubMed
GP2262 (tnrA::ermC) (available in Jörg Stülke's lab)
1A851 ( tnrA::erm), PubMed, available at BGSC
1A851 ( tnrA::erm), PubMed, available at BGSC
BKE13310 (tnrA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTTTCCACCCCTGGATG,  downstream forward: _UP4_TAAATAATAAAAGTCCGGCT
BKK13310 (tnrA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTTTCCACCCCTGGATG,  downstream forward: _UP4_TAAATAATAAAAGTCCGGCT
Expression vectors
for expression, purification in E. coli with N-terminal His-tag, in pWH844: pGP171 available in Jörg Stülke's lab
pGP229 (N-terminal Strep-tag, for SPINE, expression in B. subtilis, in pGP380), available in Jörg Stülke's lab
pGP3818 (expression of TnrA in pBQ200), available in Jörg Stülke's lab
Antibody
available in the Karl Forchhammer lab
Labs working on this gene/protein
Susan Fisher, Boston, USA homepage
Maria Schumacher, Durham, NC, USA homepage
References
Reviews
Gunka K, Commichau FM Control of glutamate homeostasis in Bacillus subtilis: a complex interplay between ammonium assimilation, glutamate biosynthesis and degradation. Molecular microbiology. 2012 Jul; 85(2):213-24. doi:10.1111/j.1365-2958.2012.08105.x. PMID:22625175
Commichau FM, Stülke J Trigger enzymes: bifunctional proteins active in metabolism and in controlling gene expression. Molecular microbiology. 2008 Feb; 67(4):692-702. . PMID:18086213
Fisher SH Regulation of nitrogen metabolism in Bacillus subtilis: vive la différence! Molecular microbiology. 1999 Apr; 32(2):223-32. . PMID:10231480
Other original publications
Schumacher MA, Chinnam NB, Cuthbert B, Tonthat NK, Whitfill T Structures of regulatory machinery reveal novel molecular mechanisms controlling B. subtilis nitrogen homeostasis. Genes & development. 2015 Feb 15; 29(4):451-64. doi:10.1101/gad.254714.114. PMID:25691471
Fujita Y, Satomura T, Tojo S, Hirooka K CcpA-mediated catabolite activation of the Bacillus subtilis ilv-leu operon and its negation by either CodY- or TnrA-mediated negative regulation. Journal of bacteriology. 2014 Nov; 196(21):3793-806. doi:10.1128/JB.02055-14. PMID:25157083
Fedorova KP, Sharafutdinov IS, Turbina EIu, Bogachev MI, Il'inskaia ON, Kaiumov AR [The C-terminus of transcription factor TnrA from Bacillus subtilis controls DNA-binding domain activity but is not required for dimerization]. Molekuliarnaia biologiia.; 47(2):331-7. . PMID:23808168
Fedorova K, Kayumov A, Woyda K, Ilinskaja O, Forchhammer K Transcription factor TnrA inhibits the biosynthetic activity of glutamine synthetase in Bacillus subtilis. FEBS letters. 2013 May 02; 587(9):1293-8. doi:10.1016/j.febslet.2013.03.015. pii:S0014-5793(13)00226-3. PMID:23535029
Kayumov A, Heinrich A, Fedorova K, Ilinskaya O, Forchhammer K Interaction of the general transcription factor TnrA with the PII-like protein GlnK and glutamine synthetase in Bacillus subtilis. The FEBS journal. 2011 May; 278(10):1779-89. doi:10.1111/j.1742-4658.2011.08102.x. PMID:21435182
Kayumov A, Heinrich A, Sharipova M, Iljinskaya O, Forchhammer K Inactivation of the general transcription factor TnrA in Bacillus subtilis by proteolysis. Microbiology (Reading, England). 2008 Aug; 154(Pt 8):2348-55. doi:10.1099/mic.0.2008/019802-0. PMID:18667567
Heinrich A, Woyda K, Brauburger K, Meiss G, Detsch C, Stülke J, Forchhammer K Interaction of the membrane-bound GlnK-AmtB complex with the master regulator of nitrogen metabolism TnrA in Bacillus subtilis. The Journal of biological chemistry. 2006 Nov 17; 281(46):34909-17. . PMID:17001076
Zalieckas JM, Wray LV, Fisher SH Cross-regulation of the Bacillus subtilis glnRA and tnrA genes provides evidence for DNA binding site discrimination by GlnR and TnrA. Journal of bacteriology. 2006 Apr; 188(7):2578-85. . PMID:16547045
Lévine A, Vannier F, Absalon C, Kuhn L, Jackson P, Scrivener E, Labas V, Vinh J, Courtney P, Garin J, Séror SJ Analysis of the dynamic Bacillus subtilis Ser/Thr/Tyr phosphoproteome implicated in a wide variety of cellular processes. Proteomics. 2006 Apr; 6(7):2157-73. . PMID:16493705
Tojo S, Satomura T, Morisaki K, Yoshida K, Hirooka K, Fujita Y Negative transcriptional regulation of the ilv-leu operon for biosynthesis of branched-chain amino acids through the Bacillus subtilis global regulator TnrA. Journal of bacteriology. 2004 Dec; 186(23):7971-9. . PMID:15547269
Belitsky BR, Sonenshein AL Modulation of activity of Bacillus subtilis regulatory proteins GltC and TnrA by glutamate dehydrogenase. Journal of bacteriology. 2004 Jun; 186(11):3399-407. . PMID:15150225
Guedon E, Moore CM, Que Q, Wang T, Ye RW, Helmann JD The global transcriptional response of Bacillus subtilis to manganese involves the MntR, Fur, TnrA and sigmaB regulons. Molecular microbiology. 2003 Sep; 49(6):1477-91. . PMID:12950915
Brandenburg JL, Wray LV, Beier L, Jarmer H, Saxild HH, Fisher SH Roles of PucR, GlnR, and TnrA in regulating expression of the Bacillus subtilis ure P3 promoter. Journal of bacteriology. 2002 Nov; 184(21):6060-4. . PMID:12374841
Belitsky BR, Wray LV, Fisher SH, Bohannon DE, Sonenshein AL Role of TnrA in nitrogen source-dependent repression of Bacillus subtilis glutamate synthase gene expression. Journal of bacteriology. 2000 Nov; 182(21):5939-47. . PMID:11029411
Robichon D, Arnaud M, Gardan R, Pragai Z, O'Reilly M, Rapoport G, Débarbouillé M Expression of a new operon from Bacillus subtilis, ykzB-ykoL, under the control of the TnrA and PhoP-phoR global regulators. Journal of bacteriology. 2000 Mar; 182(5):1226-31. . PMID:10671441
Wray LV, Ferson AE, Fisher SH Expression of the Bacillus subtilis ureABC operon is controlled by multiple regulatory factors including CodY, GlnR, TnrA, and Spo0H. Journal of bacteriology. 1997 Sep; 179(17):5494-501. . PMID:9287005
Wray LV, Ferson AE, Rohrer K, Fisher SH TnrA, a transcription factor required for global nitrogen regulation in Bacillus subtilis. Proceedings of the National Academy of Sciences of the United States of America. 1996 Aug 20; 93(17):8841-5. . PMID:8799114
Brown SW, Sonenshein AL Autogenous regulation of the Bacillus subtilis glnRA operon. Journal of bacteriology. 1996 Apr; 178(8):2450-4. . PMID:8636055
Fisher SH, Sonenshein AL Bacillus subtilis glutamine synthetase mutants pleiotropically altered in glucose catabolite repression. Journal of bacteriology. 1984 Feb; 157(2):612-21. . PMID:6141156
Schreier HJ, Brown SW, Hirschi KD, Nomellini JF, Sonenshein AL Regulation of Bacillus subtilis glutamine synthetase gene expression by the product of the glnR gene. Journal of molecular biology. 1989 Nov 05; 210(1):51-63. . PMID:2573733
The TnrA regulon
Mirouze N, Bidnenko E, Noirot P, Auger S Genome-wide mapping of TnrA-binding sites provides new insights into the TnrA regulon in Bacillus subtilis. MicrobiologyOpen. 2015 Jun; 4(3):423-35. doi:10.1002/mbo3.249. PMID:25755103
Yoshida K, Yamaguchi H, Kinehara M, Ohki YH, Nakaura Y, Fujita Y Identification of additional TnrA-regulated genes of Bacillus subtilis associated with a TnrA box. Molecular microbiology. 2003 Jul; 49(1):157-65. . PMID:12823818

857EF1AC54DEA0690C01B7F8CEFFD16312C58F20

Page visits: 9065

Time of last update: 2025-04-07 03:27:48

Author of last update: MBenda