rny

rny
168

RNase Y, 5 end sensitive endoribonuclease, involved in the degradation/ processing of mRNA, part of the putative RNA degradosome

Locus
BSU_16960
Molecular weight
58.75 kDa
Isoelectric point
5.39
Protein length
520 aaSequenceBlast
Gene length
1563 bpSequenceBlast
Function
RNA processing and degradation
Product
RNase Y
Essential
quasi
E.C.
3.1.4.16
Synonyms
rny, ymdA
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1418 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,767,310  1,768,872
Phenotypes of a mutant
quasi-essential PubMed
transcription profile resulting from rny depletion: GEO PubMed
loss of genetic competence PubMed
defect in spore germination PubMed
the mutant is strongly impaired in sporulation, genetic competence and many other traits PubMed
it is not possible to construct a rnjA rny double mutant  PubMed
the inactivation of the rny gene leads to the rapid accumulation of suppressor mutations that result in strongly reduced transcription PubMed
knockdown of expression results in loss of ICEBs1 conjugation (both in donor cells) PubMed
RNA
Interactions
the rny mRNA binds to RNA polymerase PubMed
The protein
Catalyzed reaction/ biological activity
processing, maturation and degradation of mRNAs, see RNase Y targets
RNase Y cleaves S-box mgtE riboswitch RNAs in vivo and in vitro PubMed
preference for 5' monophosphorylated substrate in vitro PubMed
endonucleolytic cleavage PubMed
required for the processing of the gapA operon mRNA PubMed
cleavage activity appears sensitive to downstream secondary structure PubMed
RNase Y initiates the degradation of rpsO mRNA PubMed
RNase Y is responsible for the degradation of 23S rRNA, 16S rRNA, and mRNAs in aging spores PubMed
RNase Y cleaves the leader of the cwlO mRNA at a stem-loop structure PubMed
3' end maturation of RNase P RNA and scRNA PubMed
Protein family
RNase Y family (single member, according to UniProt)
Domains
transmembrane domain\t(aa 524) PubMed
coiled-coiled domain (may form a leucine zipper) (aa 30-150) PubMed
KH domain\t(aa 210-280) PubMed
HD domain (aa 330-430) PubMed
C-terminal domain (aa 430-520)  PubMed
Cofactors
requires Mg2+, which can be replaced by Zn2+ or Mn2+ ions, PubMed
Structure
6F7T (PDB) (the N-teminal part, aa 1 ... 218) PubMed
O31774 (AlphaFold)
Effectors of protein activity
appears sensitive to downstream secondary structure PubMed
interaction of RNase Y with the complex of RicA-RicF-RicT stimulates the degradation and maturation of several polycistronic mRNAs PubMed
interaction of RNase Y with the complex of Eno and SR7P stimulates the degradation and maturation of several target RNAs PubMed
Localization
cell membrane,  single-pass membrane protein  PubMed
forms foci at the site of septation PubMed
Additional information
required for the processing of the gapA operon mRNA
Expression and Regulation
Operons
Genes
rny-ymdB
Description
PubMed
Regulation
constitutive
Additional information
the transcription terminator between ''rny and ymdB'' is strong and NusA-independent Reference
Open in new tab

rny→ymdB

2025-03-21 22:06:43

ghost

128

accb38d25050d34785a253e96766189dff0b632b

72F7B633B228E9BCE59B918A835E5A1613D2F9D4

Genes
rny
Description
PubMed
Regulation
constitutive
Additional information
the transcription terminator between ''rny and ymdB'' is strong and NusA-independent Reference
Open in new tab

rny

2025-03-21 22:06:34

ghost

124

21281dca59d9922ef242944ec91108fa9a8a05aa

91BEB4ADBD11915ED36147E1BC802F5F327B5118

Biological materials
Mutant
4043 (rny under p-spac control, cat), GP193 (rny under p-xyl control, cat), both available in Jörg Stülke's lab
GP2501 (Δrny::spc) available in Jörg Stülke's lab PubMed
GP2524 (rny::ermC), available in Jörg Stülke's lab
BKE16960 (rny::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATACTTTCACCTCCTCTTG,  downstream forward: _UP4_TAAAGTGATGCGCTAAGCAT
BKK16960 (rny::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATACTTTCACCTCCTCTTG,  downstream forward: _UP4_TAAAGTGATGCGCTAAGCAT
Expression vectors
N-terminal Strep-tag, expression in E. coli, in pGP172: pGP441, available in Jörg Stülke's lab
pGP2813: IPTG inducible expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab
N-terminal Strep-tag, for SPINE, expression in B. subtilis, in pGP380: pGP775, available in Jörg Stülke's lab
C-terminal Strep-tag, for SPINE, expression in B. subtilis, in pGP382: pGP1852, available in Jörg Stülke's lab
Expression of RNase Y missing the N-terminal transmembrane domain (25aa) as an intein fusion in E. coli (no tag left in the purified protein) available in the Putzer lab
wild type rny, expression in B. subtilis, in pBQ200: pGP1201, available in Jörg Stülke's lab
there is also a series of domain constructs present in pBQ200, all available in Jörg Stülke's lab
chromosomal expression of Rny-Strep, spc: GP1033, available in Jörg Stülke's lab
Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab, PubMed
FLAG-tag construct
GP1030 (spc, based on pGP1331), available in Jörg Stülke's lab
LacZ fusion
pGP459 (in pAC7), available in Jörg Stülke's lab
Antibody
available in van Dijl and in Jörg Stülke's lab
GFP fusion
B. subtilis 3569 (amyE:: (p-xyl rny-gfpmut1-spc)), available in Errington lab
pGP1368 for chromosomal expression of rny-YFP, available in Jörg Stülke's lab
Labs working on this gene/protein
Ciaran Condon, IBPC Paris, France Homepage
Harald Putzer, IBPC Paris, France Homepage
Jörg Stülke, University of Göttingen, Germany Homepage
References
Reviews
. . PMID: 39040530
Condon C, Pellegrini O, Gilet L, Durand S, Braun FWalking from E. coli to B. subtilis, one ribonuclease at a time.Comptes rendus biologies. 2021 Dec 20; 344(4):357-371. PMID: 35787606
Ul Haq I, Brantl SMoonlighting in Bacillus subtilis: The Small Proteins SR1P and SR7P Regulate the Moonlighting Activity of Glyceraldehyde 3-Phosphate Dehydrogenase A (GapA) and Enolase in RNA Degradation.Microorganisms. 2021 May 12; 9(5). PMID: 34066298
Losick R Concerns about Continuing Claims that a Protein Complex Interacts with the Phosphorelay. mBio. 2020 Mar 10; 11(2). pii:e03371-19. doi:10.1128/mBio.03371-19. PMID:32156829
Dubnau D Reply to Losick, "Concerns about Continuing Claims that a Protein Complex Interacts with the Phosphorelay". mBio. 2020 Mar 10; 11(2). pii:e00154-20. doi:10.1128/mBio.00154-20. PMID:32156813
Trinquier A, Durand S, Braun F, Condon C Regulation of RNA processing and degradation in bacteria. Biochimica et biophysica acta. Gene regulatory mechanisms. 2020 Feb 12; :194505. pii:S1874-9399(19)30265-2. doi:10.1016/j.bbagrm.2020.194505. PMID:32061882
Bechhofer DH, Deutscher MP Bacterial ribonucleases and their roles in RNA metabolism. Critical reviews in biochemistry and molecular biology. 2019 Jun; 54(3):242-300. doi:10.1080/10409238.2019.1651816. PMID:31464530
Durand S, Condon C RNases and Helicases in Gram-Positive Bacteria. Microbiology spectrum. 2018 Apr; 6(2). doi:10.1128/microbiolspec.RWR-0003-2017. PMID:29651979
Redder P Molecular and genetic interactions of the RNA degradation machineries in Firmicute bacteria. Wiley interdisciplinary reviews. RNA. 2018 Jan 05; . doi:10.1002/wrna.1460. PMID:29314657
Hui MP, Foley PL, Belasco JG Messenger RNA degradation in bacterial cells. Annual review of genetics. 2014; 48:537-59. doi:10.1146/annurev-genet-120213-092340. PMID:25292357
Laalami S, Zig L, Putzer H Initiation of mRNA decay in bacteria. Cellular and molecular life sciences : CMLS. 2014 May; 71(10):1799-828. doi:10.1007/s00018-013-1472-4. PMID:24064983
Lehnik-Habrink M, Lewis RJ, Mäder U, Stülke J RNA degradation in Bacillus subtilis: an interplay of essential endo- and exoribonucleases. Molecular microbiology. 2012 Jun; 84(6):1005-17. doi:10.1111/j.1365-2958.2012.08072.x. PMID:22568516
Bechhofer DH Bacillus subtilis mRNA decay: new parts in the toolkit. Wiley interdisciplinary reviews. RNA.; 2(3):387-94. doi:10.1002/wrna.66. PMID:21957024
Valverde R, Edwards L, Regan L Structure and function of KH domains. The FEBS journal. 2008 Jun; 275(11):2712-26. doi:10.1111/j.1742-4658.2008.06411.x. PMID:18422648
Aravind L, Koonin EV The HD domain defines a new superfamily of metal-dependent phosphohydrolases. Trends in biochemical sciences. 1998 Dec; 23(12):469-72. . PMID:9868367
Original Publications
Gilet L, Leroy M, Maes A, Condon C, Braun FUnconventional mRNA processing and degradation pathways for the polycistronic yrzI (spyTA) mRNA in Bacillus subtilis.FEBS letters. 2025 Mar 8; . PMID: 40055937
Taggart JC, Dierksheide KJ, LeBlanc HJ, Lalanne JB, Durand S, Braun F, Condon C, Li GWA high-resolution view of RNA endonuclease cleavage in Bacillus subtilis.Nucleic acids research. 2025 Jan 24; 53(3). PMID: 39883015
Laalami S, Cavaiuolo M, Oberto J, Putzer HMembrane Localization of RNase Y Is Important for Global Gene Expression in Bacillus subtilis.International journal of molecular sciences. 2024 Aug 5; 25(15). PMID: 39126106
Le Scornet A, Jousselin A, Baumas K, Kostova G, Durand S, Poljak L, Barriot R, Coutant E, Pigearias R, Tejero G, Lootvoet J, Péllisier C, Munoz G, Condon C, Redder PCritical factors for precise and efficient RNA cleavage by RNase Y in Staphylococcus aureus.PLoS genetics. 2024 Aug 1; 20(8):e1011349. PMID: 39088561
Hausnerová VV, Shoman M, Kumar D, Schwarz M, Modrák M, Matějčková JJ, Mikesková E, Neva S, Herrmannová A, Šiková M, Halada P, Novotná I, Pajer P, Valášek LS, Převorovský M, Krásný L, Hnilicová JRIP-seq reveals RNAs that interact with RNA polymerase and primary sigma factors in bacteria.Nucleic acids research. 2024 Feb 13; . PMID: 38348908
Dubnau E, DeSantis M, Dubnau DFormation of a stable RNase Y-RicT (YaaT) complex requires RicA (YmcA) and RicF (YlbF).mBio. 2023 Aug 9; :e0126923. PMID: 37555678
Korobeinikova A, Laalami S, Berthy C, Putzer HRNase Y Autoregulates Its Synthesis in Bacillus subtilis.Microorganisms. 2023 May 24; 11(6). PMID: 37374876
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Morellet N, Hardouin P, Assrir N, van Heijenoort C, Golinelli-Pimpaneau BStructural Insights into the Dimeric Form of Bacillus subtilis RNase Y Using NMR and AlphaFold.Biomolecules. 2022 Dec 1; 12(12). PMID: 36551226
Harden MM, Anderson ME, Grossman ADA CRISPR interference screen reveals a role for cell wall teichoic acids in conjugation in Bacillus subtilis.Molecular microbiology. 2022 May 1; . PMID: 35490406
Oviedo-Bocanegra LM, Hinrichs R, Rotter DAO, Dersch S, Graumann PLSingle molecule/particle tracking analysis program SMTracker 2.0 reveals different dynamics of proteins within the RNA degradosome complex in Bacillus subtilis.Nucleic acids research. 2021 Aug 20; . PMID: 34417617
Benda M, Woelfel S, Faßhauer P, Gunka K, Klumpp S, Poehlein A, Kálalová D, Šanderová H, Daniel R, Krásný L, Stülke JQuasi-essentiality of RNase Y in Bacillus subtilis is caused by its critical role in the control of mRNA homeostasis.Nucleic acids research. 2021 Jun 22; . PMID: 34157109
Durand S, Callan-Sidat A, McKeown J, Li S, Kostova G, Hernandez-Fernaud JR, Alam MT, Millard A, Allouche D, Constantinidou C, Condon C, Denham ELIdentification of an RNA sponge that controls the RoxS riboregulator of central metabolism in Bacillus subtilis.Nucleic acids research. 2021 Jun 7; . PMID: 34096591
Benda M, Schulz LM, Stülke J, Rismondo JInfluence of the ABC Transporter YtrBCDEF of Bacillus subtilis on Competence, Biofilm Formation and Cell Wall Thickness.Frontiers in microbiology. 2021; 12:587035. PMID: 33897624
Laalami S, Cavaiuolo M, Roque S, Chagneau C, Putzer HEscherichia coli RNase E can efficiently replace RNase Y in Bacillus subtilis.Nucleic acids research. 2021 Mar 31; . PMID: 33788929
Ul Haq I, Müller P, Brantl SSR7 - a dual-function antisense RNA from Bacillus subtilis.RNA biology. 2020 Aug 5; :1-14. PMID: 32752915
Hamouche L, Billaudeau C, Rocca A, Chastanet A, Ngo S, Laalami S, Putzer H Dynamic Membrane Localization of RNase Y in Bacillus subtilis. mBio. 2020 Feb 18; 11(1). pii:e03337-19. doi:10.1128/mBio.03337-19. PMID:32071272
Mora L, Ngo S, Laalami S, Putzer H In Vitro Study of the Major Bacillus subtilis Ribonucleases Y and J. Methods in enzymology. 2018; 612:343-359. pii:S0076-6879(18)30282-9. doi:10.1016/bs.mie.2018.08.004. PMID:30502948
Hardouin P, Velours C, Bou-Nader C, Assrir N, Laalami S, Putzer H, Durand D, Golinelli-Pimpaneau B Dissociation of the Dimer of the Intrinsically Disordered Domain of RNase Y upon Antibody Binding. Biophysical journal. 2018 Oct 26; . pii:S0006-3495(18)31164-0. doi:10.1016/j.bpj.2018.10.016. PMID:30447990
DeLoughery A, Lalanne JB, Losick R, Li GW Maturation of polycistronic mRNAs by the endoribonuclease RNase Y and its associated Y-complex in . Proceedings of the National Academy of Sciences of the United States of America. 2018 May 24; . pii:201803283. doi:10.1073/pnas.1803283115. PMID:29794222
Braun F, Durand S, Condon C Initiating ribosomes and a 5'/3'-UTR interaction control ribonuclease action to tightly couple B. subtilis hbs mRNA stability with translation. Nucleic acids research. 2017 Sep 07; . doi:10.1093/nar/gkx793. PMID:28977557
Tamura M, Kageyama D, Honda N, Fujimoto H, Kato A Enzymatic activity necessary to restore the lethality due to Escherichia coli RNase E deficiency is distributed among bacteria lacking RNase E homologues. PloS one. 2017; 12(5):e0177915. doi:10.1371/journal.pone.0177915. PMID:28542621
Cascante-Estepa N, Gunka K, Stülke J Localization of Components of the RNA-Degrading Machine in Bacillus subtilis. Frontiers in microbiology. 2016; 7:1492. . PMID:27708634
Gimpel M, Brantl S Dual-function sRNA encoded peptide SR1P modulates moonlighting activity of B. subtilis GapA. RNA biology. 2016 Sep; 13(9):916-26. doi:10.1080/15476286.2016.1208894. PMID:27449348
Müller P, Jahn N, Ring C, Maiwald C, Neubert R, Meißner C, Brantl S A multistress responsive type I toxin-antitoxin system: bsrE/SR5 from the B. subtilis chromosome. RNA biology. 2016 May 03; 13(5):511-23. doi:10.1080/15476286.2016.1156288. PMID:26940229
Ogura M Post-transcriptionally generated cell heterogeneity regulates biofilm formation in Bacillus subtilis. Genes to cells : devoted to molecular & cellular mechanisms. 2016 Apr; 21(4):335-49. doi:10.1111/gtc.12343. PMID:26819068
Jahn N, Brantl S Heat-shock-induced refolding entails rapid degradation of bsrG toxin mRNA by RNases Y and J1. Microbiology (Reading, England). 2016 Mar; 162(3):590-9. doi:10.1099/mic.0.000247. PMID:26802042
Salvo E, Alabi S, Liu B, Schlessinger A, Bechhofer DH Interaction of Bacillus subtilis Polynucleotide Phosphorylase and RNase Y: STRUCTURAL MAPPING AND EFFECT ON mRNA TURNOVER. The Journal of biological chemistry. 2016 Mar 25; 291(13):6655-63. doi:10.1074/jbc.M115.711044. PMID:26797123
Khemici V, Prados J, Linder P, Redder P Decay-Initiating Endoribonucleolytic Cleavage by RNase Y Is Kept under Tight Control via Sequence Preference and Sub-cellular Localisation. PLoS genetics. 2015 Oct; 11(10):e1005577. doi:10.1371/journal.pgen.1005577. PMID:26473962
DeLoughery A, Dengler V, Chai Y, Losick R Biofilm formation by Bacillus subtilis requires an endoribonuclease-containing multisubunit complex that controls mRNA levels for the matrix gene repressor SinR. Molecular microbiology. 2016 Jan; 99(2):425-37. doi:10.1111/mmi.13240. PMID:26434553
Gilet L, DiChiara JM, Figaro S, Bechhofer DH, Condon C Small stable RNA maturation and turnover in Bacillus subtilis. Molecular microbiology. 2015 Jan; 95(2):270-82. doi:10.1111/mmi.12863. PMID:25402410
Noone D, Salzberg LI, Botella E, Bäsell K, Becher D, Antelmann H, Devine KM A highly unstable transcript makes CwlO D,L-endopeptidase expression responsive to growth conditions in Bacillus subtilis. Journal of bacteriology. 2014 Jan; 196(2):237-47. doi:10.1128/JB.00986-13. PMID:24163346
Figaro S, Durand S, Gilet L, Cayet N, Sachse M, Condon C Bacillus subtilis mutants with knockouts of the genes encoding ribonucleases RNase Y and RNase J1 are viable, with major defects in cell morphology, sporulation, and competence. Journal of bacteriology. 2013 May; 195(10):2340-8. doi:10.1128/JB.00164-13. PMID:23504012
Laalami S, Bessières P, Rocca A, Zig L, Nicolas P, Putzer H Bacillus subtilis RNase Y activity in vivo analysed by tiling microarrays. PloS one. 2013; 8(1):e54062. doi:10.1371/journal.pone.0054062. PMID:23326572
Bürmann F, Sawant P, Bramkamp M Identification of interaction partners of the dynamin-like protein DynA from Bacillus subtilis. Communicative & integrative biology. 2012 Jul 01; 5(4):362-9. doi:10.4161/cib.20215. PMID:23060960
Durand S, Gilet L, Bessières P, Nicolas P, Condon C Three essential ribonucleases-RNase Y, J1, and III-control the abundance of a majority of Bacillus subtilis mRNAs. PLoS genetics. 2012; 8(3):e1002520. doi:10.1371/journal.pgen.1002520. PMID:22412379
Segev E, Smith Y, Ben-Yehuda S RNA dynamics in aging bacterial spores. Cell. 2012 Jan 20; 148(1-2):139-49. doi:10.1016/j.cell.2011.11.059. PMID:22209493
Newman JA, Hewitt L, Rodrigues C, Solovyova AS, Harwood CR, Lewis RJ Dissection of the network of interactions that links RNA processing with glycolysis in the Bacillus subtilis degradosome. Journal of molecular biology. 2012 Feb 10; 416(1):121-36. doi:10.1016/j.jmb.2011.12.024. PMID:22198292
Yao S, Richards J, Belasco JG, Bechhofer DH Decay of a model mRNA in Bacillus subtilis by a combination of RNase J1 5' exonuclease and RNase Y endonuclease activities. Journal of bacteriology. 2011 Nov; 193(22):6384-6. doi:10.1128/JB.05939-11. PMID:21908660
Deikus G, Bechhofer DH 5' End-independent RNase J1 endonuclease cleavage of Bacillus subtilis model RNA. The Journal of biological chemistry. 2011 Oct 07; 286(40):34932-40. doi:10.1074/jbc.M111.287409. PMID:21862575
Diethmaier C, Pietack N, Gunka K, Wrede C, Lehnik-Habrink M, Herzberg C, Hübner S, Stülke J A novel factor controlling bistability in Bacillus subtilis: the YmdB protein affects flagellin expression and biofilm formation. Journal of bacteriology. 2011 Nov; 193(21):5997-6007. doi:10.1128/JB.05360-11. PMID:21856853
Bruscella P, Shahbabian K, Laalami S, Putzer H RNase Y is responsible for uncoupling the expression of translation factor IF3 from that of the ribosomal proteins L35 and L20 in Bacillus subtilis. Molecular microbiology. 2011 Sep; 81(6):1526-41. doi:10.1111/j.1365-2958.2011.07793.x. PMID:21843271
Lehnik-Habrink M, Schaffer M, Mäder U, Diethmaier C, Herzberg C, Stülke J RNA processing in Bacillus subtilis: identification of targets of the essential RNase Y. Molecular microbiology. 2011 Sep; 81(6):1459-73. doi:10.1111/j.1365-2958.2011.07777.x. PMID:21815947
Lehnik-Habrink M, Newman J, Rothe FM, Solovyova AS, Rodrigues C, Herzberg C, Commichau FM, Lewis RJ, Stülke J RNase Y in Bacillus subtilis: a Natively disordered protein that is the functional equivalent of RNase E from Escherichia coli. Journal of bacteriology. 2011 Oct; 193(19):5431-41. doi:10.1128/JB.05500-11. PMID:21803996
Lehnik-Habrink M, Newman J, Rothe FM, Solovyova AS, Rodrigues C, Herzberg C, Commichau FM, Lewis RJ, Stülke J RNase Y in Bacillus subtilis: a Natively disordered protein that is the functional equivalent of RNase E from Escherichia coli. Journal of bacteriology. 2011 Oct; 193(19):5431-41. doi:10.1128/JB.05500-11. PMID:21803996
Lehnik-Habrink M, Pförtner H, Rempeters L, Pietack N, Herzberg C, Stülke J The RNA degradosome in Bacillus subtilis: identification of CshA as the major RNA helicase in the multiprotein complex. Molecular microbiology. 2010 Aug; 77(4):958-71. doi:10.1111/j.1365-2958.2010.07264.x. PMID:20572937
Irnov I, Sharma CM, Vogel J, Winkler WC Identification of regulatory RNAs in Bacillus subtilis. Nucleic acids research. 2010 Oct; 38(19):6637-51. doi:10.1093/nar/gkq454. PMID:20525796
Yao S, Bechhofer DH Initiation of decay of Bacillus subtilis rpsO mRNA by endoribonuclease RNase Y. Journal of bacteriology. 2010 Jul; 192(13):3279-86. doi:10.1128/JB.00230-10. PMID:20418391
Zweers JC, Wiegert T, van Dijl JM Stress-responsive systems set specific limits to the overproduction of membrane proteins in Bacillus subtilis. Applied and environmental microbiology. 2009 Dec; 75(23):7356-64. doi:10.1128/AEM.01560-09. PMID:19820159
Shahbabian K, Jamalli A, Zig L, Putzer H RNase Y, a novel endoribonuclease, initiates riboswitch turnover in Bacillus subtilis. The EMBO journal. 2009 Nov 18; 28(22):3523-33. doi:10.1038/emboj.2009.283. PMID:19779461
Commichau FM, Rothe FM, Herzberg C, Wagner E, Hellwig D, Lehnik-Habrink M, Hammer E, Völker U, Stülke J Novel activities of glycolytic enzymes in Bacillus subtilis: interactions with essential proteins involved in mRNA processing. Molecular & cellular proteomics : MCP. 2009 Jun; 8(6):1350-60. doi:10.1074/mcp.M800546-MCP200. PMID:19193632
Hahne H, Wolff S, Hecker M, Becher D From complementarity to comprehensiveness--targeting the membrane proteome of growing Bacillus subtilis by divergent approaches. Proteomics. 2008 Oct; 8(19):4123-36. doi:10.1002/pmic.200800258. PMID:18763711
Hunt A, Rawlins JP, Thomaides HB, Errington J Functional analysis of 11 putative essential genes in Bacillus subtilis. Microbiology (Reading, England). 2006 Oct; 152(Pt 10):2895-907. . PMID:17005971

872CCB5A49C9000BD95E4B0472556D5F60F7D7A4

Page visits: 11356

Time of last update: 2025-04-04 03:58:41

Author of last update: Jstuelk