dgcW

dgcW
168

diguanylate cyclase and potential phosphodiesterase

Locus
BSU_13420
Molecular weight
84.63 kDa
Isoelectric point
6.82
Protein length
Gene length
Function
synthesis of c-di-GMP
Product
diguanylate cyclase and potential phosphodiesterase
Essential
no
Synonyms
dgcW, ykoW

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3300 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,407,329  1,409,578
The protein
Catalyzed reaction/ biological activity
synthesis of c-di-GMP from two molecules of GTP PubMed
MHYT domain (aa 7-201) (according to UniProt)
contains a N-terminal PAS domain PubMed
contains a central GGDEF domain and a C-terminal EAL domain PubMed
aa 290-735 are similar to E.  coli CsrD (18% identity, 43% similarity)
Structure
5XGB (PDB) (from Pseudomonas aeruginosa, corresponds to the C-terminal part of DgcW, aa 194 ... 735, 29% identity) PubMed
cell membrane (according to Swiss-Prot)
Expression and Regulation
Operons
Genes
Description
Sigma factors
SigD: sigma factor, PubMed, in sigD regulon
Open in new tab

dgcW

2025-03-18 06:51:28

ghost

76

3e750b0ff0745774be04b232f89ddb7bd76cf215

D6074E82B5ABD2EBA34CE3DEF4860CF155B238CC

Biological materials
Mutant
MGNA-B314 (ykoW::erm), available at the NBRP B. subtilis, Japan
BP140 (''dgcW::ermC'') available in Fabian Commichau's lab
BP142 (''dgcW-ykoV-ligD::kan'') available in Fabian Commichau's lab
BKE13420 (dgcW::erm  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CAAATGGAGATTCCCCCCGT,  downstream forward: _UP4_TAACAGCGCCGGCTTTTTTT
BKK13420 (dgcW::kan  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CAAATGGAGATTCCCCCCGT,  downstream forward: _UP4_TAACAGCGCCGGCTTTTTTT
Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab
References
Liu C, Liew CW, Wong YH, Tan ST, Poh WH, Manimekalai SMS, Rajan S, Xin L, Liang ZX, Grüber G, Rice SA, Lescar J Insights into biofilm dispersal regulation from the crystal structure of the PAS-GGDEF-EAL region of RbdA from . Journal of bacteriology. 2017 Nov 06; . pii:JB.00515-17. doi:10.1128/JB.00515-17. PMID:29109186
Arrieta-Ortiz ML, Hafemeister C, Bate AR, Chu T, Greenfield A, Shuster B, Barry SN, Gallitto M, Liu B, Kacmarczyk T, Santoriello F, Chen J, Rodrigues CD, Sato T, Rudner DZ, Driks A, Bonneau R, Eichenberger P An experimentally supported model of the Bacillus subtilis global transcriptional regulatory network. Molecular systems biology. 2015 Nov 17; 11(11):839. doi:10.15252/msb.20156236. PMID:26577401
Gao X, Mukherjee S, Matthews PM, Hammad LA, Kearns DB, Dann CE Functional characterization of core components of the Bacillus subtilis cyclic-di-GMP signaling pathway. Journal of bacteriology. 2013 Nov; 195(21):4782-92. doi:10.1128/JB.00373-13. PMID:23893111
Chen Y, Chai Y, Guo JH, Losick R Evidence for cyclic Di-GMP-mediated signaling in Bacillus subtilis. Journal of bacteriology. 2012 Sep; 194(18):5080-90. doi:10.1128/JB.01092-12. PMID:22821967
Nicolas P, Mäder U, Dervyn E, Rochat T, Leduc A, Pigeonneau N, Bidnenko E, Marchadier E, Hoebeke M, Aymerich S, Becher D, Bisicchia P, Botella E, Delumeau O, Doherty G, Denham EL, Fogg MJ, Fromion V, Goelzer A, Hansen A, Härtig E, Harwood CR, Homuth G, Jarmer H, Jules M, Klipp E, Le Chat L, Lecointe F, Lewis P, Liebermeister W, March A, Mars RA, Nannapaneni P, Noone D, Pohl S, Rinn B, Rügheimer F, Sappa PK, Samson F, Schaffer M, Schwikowski B, Steil L, Stülke J, Wiegert T, Devine KM, Wilkinson AJ, van Dijl JM, Hecker M, Völker U, Bessières P, Noirot P Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science (New York, N.Y.). 2012 Mar 02; 335(6072):1103-6. doi:10.1126/science.1206848. PMID:22383849
Suzuki K, Babitzke P, Kushner SR, Romeo T Identification of a novel regulatory protein (CsrD) that targets the global regulatory RNAs CsrB and CsrC for degradation by RNase E. Genes & development. 2006 Sep 15; 20(18):2605-17. . PMID:16980588
Galperin MY, Gaidenko TA, Mulkidjanian AY, Nakano M, Price CW MHYT, a new integral membrane sensor domain. FEMS microbiology letters. 2001 Nov 27; 205(1):17-23. . PMID:11728710

A2E6852A5739B3C04405B98AFFC301A98E1ADCD0

Page visits: 5447

Time of last update: 2025-04-07 00:53:28

Author of last update: Jstuelk