pdhB

pdhB
168

pyruvate dehydrogenase (E1 beta subunit)

Locus
BSU_14590
Molecular weight
35.32 kDa
Isoelectric point
4.55
Protein length
325 aaSequenceBlast
Gene length
978 bpSequenceBlast
Function
links glycolysis and TCA cycle
Product
pyruvate dehydrogenase (E1 beta subunit)
Essential
no
E.C.
1.2.4.1
Synonyms
pdhB
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0022 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,529,445 1,530,422
Phenotypes of a mutant
the mutant tends to acquire suppressor mutations that result in improved growth PubMed
defects in sporulation and unable to grow on glucose as single carbon source PubMed
poor growth PubMed
non-transformable PubMed
The protein
Catalyzed reaction/ biological activity
[dihydrolipoyllysine-residue acetyltransferase]-(R)-N6-lipoyl-L-lysine + H+ + pyruvate --> [dihydrolipoyllysine-residue acetyltransferase]-(R)-N6-(S8-acetyldihydrolipoyl)-L-lysine + CO2 (according to UniProt)
Structure
1W88 (PDB) (E1 in complex with subunit binding domain of E2, Geobacillus stearothermophilus) PubMed
P21882 (AlphaFold)
Modification
phosphorylation on (Ser-302 OR Ser-306) PubMed
Effectors of protein activity
Inhibited thiamine 2-thiothiazolone diphosphate and NADH PubMed
Low sensibility to NADPH
inhibited upon interaction with PdhI PubMed
Kinetic information
Michaelis-Menten PubMed
Paralogous protein(s)
AcoB, BkdAB
Localization
membrane associated PubMed
Additional information
belongs to the 100 most abundant proteins PubMed
Expression and Regulation
Operons
Genes
pdhA-pdhB-pdhC-pdhD
Description
PubMed
Regulation
''pdhA'': expression activated by glucose (1.9-fold) PubMed
Regulatory mechanism
stringent response: negative regulation, due to presence of guanine at 1 position of the transcript PubMed, in stringent response
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Open in new tab

pdhA→pdhD

2025-03-29 04:16:44

ghost

117

797fea7dcbe4317f63eb94d44165272d12ff3ae4

3D5EA61F84C1F6538A394D4F9A00FD4029ED115F

Biological materials
Mutant
GP459 (spc), available in Jörg Stülke's lab
BKE14590 (pdhB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_AATCATTGTCATTTGCGCCA, downstream forward: _UP4_TAATCAAACTGCATAATCGA
BKK14590 (pdhB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_AATCATTGTCATTTGCGCCA, downstream forward: _UP4_TAATCAAACTGCATAATCGA
Expression vectors
pGP2823 (for the purification of PdhA-PdhB-His6 in E. coli, in pET28a), available in Jörg Stülke's lab
pGP2900 (for the purification of Strep-PdhA-PdhB in E. coli, in pGP172), available in Jörg Stülke's lab
pGP3713 (for the purification of Strep-PdhA-PdhB-PdhC-PdhD in B. subtilis, in pGP380), available in Jörg Stülke's lab
Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab
LacZ fusion
pGP722 (in pAC5), available in Jörg Stülke's lab
Labs working on this gene/protein
Arthur Aronson, Purdue University, West Lafayette, USA homepage
References
Reviews
Patel MS, Nemeria NS, Furey W, Jordan F The pyruvate dehydrogenase complexes: structure-based function and regulation. The Journal of biological chemistry. 2014 Jun 13; 289(24):16615-23. doi:10.1074/jbc.R114.563148. PMID:24798336
Tittmann K Reaction mechanisms of thiamin diphosphate enzymes: redox reactions. The FEBS journal. 2009 May; 276(9):2454-68. doi:10.1111/j.1742-4658.2009.06966.x. PMID:19476487
Neveling U, Bringer-Meyer S, Sahm H Gene and subunit organization of bacterial pyruvate dehydrogenase complexes. Biochimica et biophysica acta. 1998 Jun 29; 1385(2):367-72. . PMID:9655937
Frey PA Mechanism of coupled electron and group transfer in Escherichia coli pyruvate dehydrogenase. Annals of the New York Academy of Sciences. 1982; 378:250-64. . PMID:6805383
Patel MS, Roche TE Molecular biology and biochemistry of pyruvate dehydrogenase complexes. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 1990 Nov; 4(14):3224-33. . PMID:2227213
Original Publications
Kilian M, Bischofs IBCo-evolution at protein-protein interfaces guides inference of stoichiometry of oligomeric protein complexes by de novo structure prediction.Molecular microbiology. 2023 Sep 30; . PMID: 37777474
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Koo BM, Kritikos G, Farelli JD, Todor H, Tong K, Kimsey H, Wapinski I, Galardini M, Cabal A, Peters JM, Hachmann AB, Rudner DZ, Allen KN, Typas A, Gross CA Construction and Analysis of Two Genome-Scale Deletion Libraries for Bacillus subtilis. Cell systems. 2017 Mar 22; 4(3):291-305.e7. pii:S2405-4712(16)30447-1. doi:10.1016/j.cels.2016.12.013. PMID:28189581
Hahne H, Wolff S, Hecker M, Becher D From complementarity to comprehensiveness--targeting the membrane proteome of growing Bacillus subtilis by divergent approaches. Proteomics. 2008 Oct; 8(19):4123-36. doi:10.1002/pmic.200800258. PMID:18763711
Macek B, Mijakovic I, Olsen JV, Gnad F, Kumar C, Jensen PR, Mann M The serine/threonine/tyrosine phosphoproteome of the model bacterium Bacillus subtilis. Molecular & cellular proteomics : MCP. 2007 Apr; 6(4):697-707. . PMID:17218307
Frank RA, Titman CM, Pratap JV, Luisi BF, Perham RNA molecular switch and proton wire synchronize the active sites in thiamine enzymes.Science (New York, N.Y.). 2004 Oct 29; 306(5697):872-6. PMID: 15514159
Eymann C, Dreisbach A, Albrecht D, Bernhardt J, Becher D, Gentner S, Tam le T, Büttner K, Buurman G, Scharf C, Venz S, Völker U, Hecker M A comprehensive proteome map of growing Bacillus subtilis cells. Proteomics. 2004 Oct; 4(10):2849-76. . PMID:15378759
Blencke HM, Homuth G, Ludwig H, Mäder U, Hecker M, Stülke J Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways. Metabolic engineering. 2003 Apr; 5(2):133-49. . PMID:12850135
Gao H, Jiang X, Pogliano K, Aronson AI The E1beta and E2 subunits of the Bacillus subtilis pyruvate dehydrogenase complex are involved in regulation of sporulation. Journal of bacteriology. 2002 May; 184(10):2780-8. . PMID:11976308
Nakano MM, Dailly YP, Zuber P, Clark DP Characterization of anaerobic fermentative growth of Bacillus subtilis: identification of fermentation end products and genes required for growth. Journal of bacteriology. 1997 Nov; 179(21):6749-55. . PMID:9352926
Lowe PN, Hodgson JA, Perham RN Dual role of a single multienzyme complex in the oxidative decarboxylation of pyruvate and branched-chain 2-oxo acids in Bacillus subtilis. The Biochemical journal. 1983 Oct 01; 215(1):133-40. . PMID:6414463

458E967052D1093A0F48AE0E6B6CCA0F52EAC44D

Page visits: 4728

Time of last update: 2025-04-10 14:35:16

Author of last update: Jstuelk