pfkA
168

phosphofructokinase, glycolytic enzyme

Locus

BSU_29190

Molecular weight

34.10 kDa

Isoelectric point

6.14

Protein length

319 aaSequenceBlast

Gene length

960 bpSequenceBlast

Function

catabolic enzyme in glycolysis

Product

6-phosphofructokinase

Essential

E.C.

2.7.1.11

Synonyms

pfkA, pfk

Outlinks

BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Carbon metabolism, Carbon core metabolism, Glycolysis

Information processing, Genetics, Newly identified competence genes

Groups of genes, Phosphoproteins, Phosphorylation on an Arg residue

List of homologs in different organisms, belongs to COG0205 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene

Coordinates

2,986,588 2,987,547

Phenotypes of a mutant

essential according to PubMed, non-essential according to PubMed

poor growth PubMed

poorly transformable PubMed

increased resistance to diamide PubMed

The protein

Catalyzed reaction/ biological activity

ATP + β-D-fructose-6-P --> ADP + β-D-fructose-1,6-bisphosphate + H⁺ (according to UniProt)

Protein family

phosphofructokinase type A (PFKA) family (single member, according to UniProt)

Domains

3 x nucleotide binding domain (ATP) (2125), (154158), (171187)

Cofactors

Mg2+

Structure

4A3S (PDB) PubMed

1MTO (PDB) (mutant, complex with fructose-6-P, Geobacillus stearothermophilus)

4PFK (PDB) (Geobacillus stearothermophilus)

O34529 (AlphaFold)

Modification

phosphorylated on Arg-233 PubMed

Effectors of protein activity

Inhibited by citrate, PEP (Hill Coefficient 3) and Ca2+ (competes with Mg2+) in B. licheniformes PubMed.

Inhibited by ATP (competitively) and fructose-6-P (non-competitively) in G. stearothermophillus PubMed

Activated by GDP and ADP in lower concentrations (1 mM); above that inhibition, competing with the ATP for the binding site (in G. stearothermophillus) PubMed

Activated by NH4+ PubMed

Kinetic information

Allosteric Regulation (Reversible) PubMed

Localization

cytoplasm (homogeneous) PubMed

Additional information

PfkA is a moonlighting protein PubMed

extensive information on the structure and enzymatic properties of PfkA can be found at Proteopedia

Expression and Regulation

Operons

Genes

pfkA-pyk-ytzA

Description

PubMed

Regulation

twofold induced by glucose PubMed

Open in new tab

Biological materials

Mutant

GP590 (pfkA::cat), available in Jörg Stülke's lab, PubMed

GP595 (pfkA::erm), available in Jörg Stülke's lab, PubMed

GP1744: BSB1 pfkA::aphA3, available in Jörg Stülke' lab

GP1747: pfkA::aphA3, available in Jörg Stülke' lab, PubMed

BKE29190 (pfkA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCTCCATTCACCTCAGC, downstream forward: _UP4_TAATGTACAGCTGAAGGCTG

BKK29190 (pfkA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCTCCATTCACCTCAGC, downstream forward: _UP4_TAATGTACAGCTGAAGGCTG

Expression vectors

for expression/ purification from B. subtilis with N-terminal Strep-tag, for SPINE, in pGP380: pGP87, available in Jörg Stülke's lab, PubMed

for expression/ purification from B. subtilis with C-terminal Strep-tag, for SPINE, in pGP382: pGP1266, available in Jörg Stülke's lab

for expression/ purification from E. coli with N-terminal His-tag, in pWH844: pGP393, available in Jörg Stülke's lab

for expression in B. subtilis, in pBQ200: pGP1422, available in Jörg Stülke's lab

Two-hybrid system

B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab, PubMed

FLAG-tag construct

GP1019 (spc, based on pGP1331), available in Jörg Stülke's lab

LacZ fusion

pGP511 (in pAC6), available in Jörg Stülke's lab

GFP fusion

GP1720 (in pBP43), expression of pfkA-GFP::spc under the native promoter, available in Jörg Stülke's lab PubMed

Labs working on this gene/protein

Jörg Stülke, University of Göttingen, Germany Homepage

References

Haq IU, Müller P, Brantl SA comprehensive study of the interactions in the B. subtilis degradosome with special emphasis on the role of the small proteins SR1P and SR7P.Molecular microbiology. 2023 Nov 22; . PMID: 37994189

Walgraeve J, Ferrero-Bordera B, Maaß S, Becher D, Schwerdtfeger R, van Dijl JM, Seefried MDiamide-based screening method for the isolation of improved oxidative stress tolerance phenotypes in Bacillus mutant libraries.Microbiology spectrum. 2023 Oct 11; :e0160823. PMID: 37819171

Oviedo-Bocanegra LM, Hinrichs R, Rotter DAO, Dersch S, Graumann PLSingle molecule/particle tracking analysis program SMTracker 2.0 reveals different dynamics of proteins within the RNA degradosome complex in Bacillus subtilis.Nucleic acids research. 2021 Aug 20; . PMID: 34417617

El Najjar N, El Andari J, Kaimer C, Fritz G, Rösch TC, Graumann PL Study of DNA translocases inby single molecule tracking reveals strikingly different dynamics of SftA, SpoIIIE and FtsA. Applied and environmental microbiology. 2018 Feb 09; . pii:AEM.02610-17. doi:10.1128/AEM.02610-17. PMID:29439991

Koo BM, Kritikos G, Farelli JD, Todor H, Tong K, Kimsey H, Wapinski I, Galardini M, Cabal A, Peters JM, Hachmann AB, Rudner DZ, Allen KN, Typas A, Gross CA Construction and Analysis of Two Genome-Scale Deletion Libraries for Bacillus subtilis. Cell systems. 2017 Mar 22; 4(3):291-305.e7. pii:S2405-4712(16)30447-1. doi:10.1016/j.cels.2016.12.013. PMID:28189581

Cascante-Estepa N, Gunka K, Stülke J Localization of Components of the RNA-Degrading Machine in Bacillus subtilis. Frontiers in microbiology. 2016; 7:1492. . PMID:27708634

Commichau FM, Pietack N, Stülke J Essential genes in Bacillus subtilis: a re-evaluation after ten years. Molecular bioSystems. 2013 Jun; 9(6):1068-75. doi:10.1039/c3mb25595f. PMID:23420519

Elsholz AK, Turgay K, Michalik S, Hessling B, Gronau K, Oertel D, Mäder U, Bernhardt J, Becher D, Hecker M, Gerth U Global impact of protein arginine phosphorylation on the physiology of Bacillus subtilis. Proceedings of the National Academy of Sciences of the United States of America. 2012 May 08; 109(19):7451-6. doi:10.1073/pnas.1117483109. PMID:22517742

Newman JA, Hewitt L, Rodrigues C, Solovyova AS, Harwood CR, Lewis RJ Dissection of the network of interactions that links RNA processing with glycolysis in the Bacillus subtilis degradosome. Journal of molecular biology. 2012 Feb 10; 416(1):121-36. doi:10.1016/j.jmb.2011.12.024. PMID:22198292

Lehnik-Habrink M, Newman J, Rothe FM, Solovyova AS, Rodrigues C, Herzberg C, Commichau FM, Lewis RJ, Stülke J RNase Y in Bacillus subtilis: a Natively disordered protein that is the functional equivalent of RNase E from Escherichia coli. Journal of bacteriology. 2011 Oct; 193(19):5431-41. doi:10.1128/JB.05500-11. PMID:21803996

Lehnik-Habrink M, Pförtner H, Rempeters L, Pietack N, Herzberg C, Stülke J The RNA degradosome in Bacillus subtilis: identification of CshA as the major RNA helicase in the multiprotein complex. Molecular microbiology. 2010 Aug; 77(4):958-71. doi:10.1111/j.1365-2958.2010.07264.x. PMID:20572937

Muñoz-Márquez ME, Ponce-Rivas E Effect of pfkA chromosomal interruption on growth, sporulation, and production of organic acids in Bacillus subtilis. Journal of basic microbiology. 2010 Jun; 50(3):232-40. doi:10.1002/jobm.200900236. PMID:20473954

Commichau FM, Rothe FM, Herzberg C, Wagner E, Hellwig D, Lehnik-Habrink M, Hammer E, Völker U, Stülke J Novel activities of glycolytic enzymes in Bacillus subtilis: interactions with essential proteins involved in mRNA processing. Molecular & cellular proteomics : MCP. 2009 Jun; 8(6):1350-60. doi:10.1074/mcp.M800546-MCP200. PMID:19193632

Meile JC, Wu LJ, Ehrlich SD, Errington J, Noirot P Systematic localisation of proteins fused to the green fluorescent protein in Bacillus subtilis: identification of new proteins at the DNA replication factory. Proteomics. 2006 Apr; 6(7):2135-46. . PMID:16479537

Ludwig H, Homuth G, Schmalisch M, Dyka FM, Hecker M, Stülke J Transcription of glycolytic genes and operons in Bacillus subtilis: evidence for the presence of multiple levels of control of the gapA operon. Molecular microbiology. 2001 Jul; 41(2):409-22. . PMID:11489127

Byrnes M, Zhu X, Younathan ES, Chang SH Kinetic characteristics of phosphofructokinase from Bacillus stearothermophilus: MgATP nonallosterically inhibits the enzyme. Biochemistry. 1994 Mar 22; 33(11):3424-31. . PMID:8136379

Zhu X, Byrnes M, Nelson JW, Chang SH Role of glycine 212 in the allosteric behavior of phosphofructokinase from Bacillus stearothermophilus. Biochemistry. 1995 Feb 28; 34(8):2560-5. . PMID:7873536

Marschke CK, Bernlohr RW Purification and characterization of phosphofructokinase of Bacillus licheniformis. Archives of biochemistry and biophysics. 1973 May; 156(1):1-16. . PMID:4269800

Page visits: 10920

Time of last update: 2025-04-07 05:00:52

Author of last update: Jstuelk

pfkA 168

pfkA
168