hprT
168

trigger enzyme, hypoxanthine phosphoribosyltransferase and part of a transcription activator

Locus

BSU_00680

Molecular weight

20.10 kDa

Isoelectric point

4.6

Protein length

180 aaSequenceBlast

Gene length

543 bpSequenceBlast

Function

purine salvage and interconversion, control of ftsH expression

Product

hypoxanthine phosphoribosyltransferase

Essential

E.C.

2.4.2.8

Synonyms

hprT

Outlinks

BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Nucleotide metabolism, Biosynthesis/ acquisition of nucleotides, Purine salvage and interconversion

Information processing, Regulation of gene expression, Transcription factors and their control, Transcription factors/ other

Information processing, Regulation of gene expression, Transcription factors and their control, Control of transcription factor (other than two-component system)

Information processing, Targets of second messengers, Targets of (p)ppGpp

Lifestyles, Coping with stress, Cell envelope stress proteins (controlled by SigM, V, W, X, Y)

List of homologs in different organisms, belongs to COG0634 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, SigM regulon, SigF regulon, TilS regulon, HprT regulon

Gene

Coordinates

76,344 → 76,886

Phenotypes of a mutant

essential PubMed, non-essential according to PubMed

inactivation of hprT can overcome the toxicity of guanosine to a rel sasA sasB triple mutant PubMed

The protein

Catalyzed reaction/ biological activity

diphosphate + IMP --> 5-phospho-α-D-ribose 1-diphosphate + hypoxanthine (according to UniProt)

diphosphate + GMP --> 5-phospho-α-D-ribose 1-diphosphate + guanine (according to UniProt)

Protein family

Purine/pyrimidine phosphoribosyltransferase family (according to UniProt)

Structure

6D9Q (PDB) (apo-protein) PubMed

6D9R (PDB) (complex with the substrate PRPP) PubMed

6D9S (PDB) (complex with ppGpp) PubMed

P37472 (AlphaFold)

Effectors of protein activity

inhibition of enzymatic activity by (p)ppGpp during the ´stringent response´, (p)ppGpp binds to the acive site of the enzyme and prevents the conversion of the apo-tetramer to the active dimer PubMed

Kinetic information

K_M (PRPP): 166 µM PubMed

K_I (pppGpp): 1.7 µM PubMed

Localization

cytoplasm (according to UniProt)

Expression and Regulation

Operons

Genes

tilS-hprT-ftsH

Description

PubMed

Regulation

induced by heat shock (class III)

Regulatory mechanism

TilS: activation, with HprT PubMed, in tilS regulon

HprT: activation, with TilS PubMed, in hprT regulon

Sigma factors

SigM: sigma factor, PubMed, in sigM regulon

SigA: sigma factor, PubMed, in sigA regulon

Additional information

the mRNA is very stable (half-life > 15 min) PubMed

Open in new tab

Genes

spoIIE-yabS-yabT-tilS-hprT-ftsH

Description

PubMed

Regulation

expressed early during sporulation in the forespore (SigF) PubMed

Sigma factors

SigF: sigma factor, PubMed, in sigF regulon

Open in new tab

Biological materials

Mutant

BKE00680 (ΔhprT::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCATGATTTTGCTTGCCC, downstream forward: _UP4_TGATCGGCAGCCTGCTTCCG

BKK00680 (ΔhprT::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCATGATTTTGCTTGCCC, downstream forward: _UP4_TGATCGGCAGCCTGCTTCCG

References

Reviews

Hove-Jensen B, Andersen KR, Kilstrup M, Martinussen J, Switzer RL, Willemoës M Phosphoribosyl Diphosphate (PRPP): Biosynthesis, Enzymology, Utilization, and Metabolic Significance. Microbiology and molecular biology reviews : MMBR. 2017 Mar; 81(1). pii:e00040-16. doi:10.1128/MMBR.00040-16. PMID:28031352

Original Publications

She F, Liu K, Anderson BW, Pisithkul T, Li Y, Fung DK, McCue T, Mulhern W, Amador-Noguez D, Wang JDPyruvate Kinase Directly Generates GTP in Glycolysis, Supporting Growth and Contributing to Guanosine Toxicity.bioRxiv : the preprint server for biology. 2024 Dec 18; . PMID: 39763737

Anderson BW, Liu K, Wolak C, Dubiel K, She F, Satyshur KA, Keck JL, Wang JD Evolution of (p)ppGpp-HPRT regulation through diversification of an allosteric oligomeric interaction. eLife. 2019 Sep 25; 8. doi:10.7554/eLife.47534. pii:e47534. PMID:31552824

Koo BM, Kritikos G, Farelli JD, Todor H, Tong K, Kimsey H, Wapinski I, Galardini M, Cabal A, Peters JM, Hachmann AB, Rudner DZ, Allen KN, Typas A, Gross CA Construction and Analysis of Two Genome-Scale Deletion Libraries for Bacillus subtilis. Cell systems. 2017 Mar 22; 4(3):291-305.e7. pii:S2405-4712(16)30447-1. doi:10.1016/j.cels.2016.12.013. PMID:28189581

Lin TH, Hu YN, Shaw GC Two enzymes, TilS and HprT, can form a complex to function as a transcriptional activator for the cell division protease gene ftsH in Bacillus subtilis. Journal of biochemistry. 2014 Jan; 155(1):5-16. doi:10.1093/jb/mvt081. PMID:24001521

Kriel A, Bittner AN, Kim SH, Liu K, Tehranchi AK, Zou WY, Rendon S, Chen R, Tu BP, Wang JD Direct regulation of GTP homeostasis by (p)ppGpp: a critical component of viability and stress resistance. Molecular cell. 2012 Oct 26; 48(2):231-41. doi:10.1016/j.molcel.2012.08.009. pii:S1097-2765(12)00696-X. PMID:22981860

Eiamphungporn W, Helmann JD The Bacillus subtilis sigma(M) regulon and its contribution to cell envelope stress responses. Molecular microbiology. 2008 Feb; 67(4):830-48. doi:10.1111/j.1365-2958.2007.06090.x. PMID:18179421

Endo T, Uratani B, Freese E Purine salvage pathways of Bacillus subtilis and effect of guanine on growth of GMP reductase mutants. Journal of bacteriology. 1983 Jul; 155(1):169-79. . PMID:6408059

Page visits: 4857

Time of last update: 2025-04-07 05:45:56

Author of last update: Jstuelk

hprT 168

hprT
168