ptsG
168

glucose permease of the phosphotransferase system, EIICBA of the PTS, Trigger enzyme, control of GlcT activity

Locus

BSU_13890

Molecular weight

75.34 kDa

Isoelectric point

5.41

Protein length

699 aaSequenceBlast

Gene length

2100 bpSequenceBlast

Function

glucose transport and phosphorylation, control of GlcT activity

Product

glucose permease, trigger enzyme

Essential

E.C.

2.7.1.69

Synonyms

ptsG, ptsX, crr

Outlinks

BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2190 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene

Coordinates

1,457,187 → 1,459,286

The protein

Catalyzed reaction/ biological activity

transport and phosphorylation of glucose, receives a phosphate from HPr]] at the IIA domain (His-620), the phosphate group is then transferred to the IIB domain (Cys-461) an finally to the incoming glucose. In the absence of glucose, PtsG phosphorylates and thereby inactivates the transcriptional antiterminator GlcT.

D-glucose + N^π-phospho-L-histidyl-[protein] --> D-glucose-6-P + L-histidyl-[protein] (according to UniProt)

Protein family

PTS permease, glucose family PubMed

Domains

11x transmembrane domain (16–36, 89–109, 139–159, 180–200, 233–253, 283–303, 313–333, 338–358, 365–385, 388–408)

PTS EIIA domain type-1 (aa 568–672) (according to UniProt)

PTS EIIB domain type-1 (aa 439–520) (according to UniProt)

PTS EIIC domain type-1 (aa 1-424) (according to UniProt)

Structure

8QSR (PDB) (the IIC dimer of E. coli PtsG, 47% identity) PubMed

5IWS (PDB) (the IIC domain of B. cereus MalT, 32% identity) PubMed

1AX3 (PDB) (IIA domain) PubMed

1GPR (PDB) (IIA domain)

P20166 (AlphaFold)

Modification

transient phosphorylation (HPr]]-dependent) on His-620, then internal phosphotransfer from His-620 to Cys-461

Paralogous protein(s)

MalP, NagP, GamP

Localization

membrane protein PubMed

Expression and Regulation

Operons

Genes

ptsG-ptsH-ptsI

Description

PubMed

Regulation

expression activated by glucose (2 fold) (GlcT) PubMed

Regulatory mechanism

stringent response: negative regulation, in stringent response

GlcT: antitermination, via the GlcT-dependent RNA switch PubMed, in glcT regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Open in new tab

Biological materials

Mutant

GP778 (ΔglcT-ptsG-ptsH-ptsI::spc) PubMed, available in Jörg Stülke's lab

BKE13890 (ΔptsG::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT

BKK13890 (ΔptsG::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT

Expression vectors

pGP123 (domains BA, in pWH844), available in Jörg Stülke's lab

pGP141 (domains BA, mut: H620D, in pWH844), available in Jörg Stülke's lab

pGP428 (EIIB, in pWH844), available in Jörg Stülke's lab

pGP437(EIIA in pGP570, with thrombin cleavage site), available in Jörg Stülke's lab

LacZ fusion

pGP34 (pAC5) PubMed, available in Jörg Stülke's lab

pGP66 (pAC7) PubMed, available in Jörg Stülke's lab

pGP606 (mutant terminator, pAC6), available in Jörg Stülke's lab

pGP532 (pAC7), available in Jörg Stülke's lab

series of promoter deletions are available in pAC5 and pAC6, available in Jörg Stülke's lab

series of RAT mutants are available in pAC6, available in Jörg Stülke's lab

Labs working on this gene/protein

Jörg Stülke, University of Göttingen, Germany Homepage

References

Reviews

Deutscher J, Aké FM, Derkaoui M, Zébré AC, Cao TN, Bouraoui H, Kentache T, Mokhtari A, Milohanic E, Joyet P The bacterial phosphoenolpyruvate:carbohydrate phosphotransferase system: regulation by protein phosphorylation and phosphorylation-dependent protein-protein interactions. Microbiology and molecular biology reviews : MMBR. 2014 Jun; 78(2):231-56. doi:10.1128/MMBR.00001-14. PMID:24847021

Görke B, Stülke J Carbon catabolite repression in bacteria: many ways to make the most out of nutrients. Nature reviews. Microbiology. 2008 Aug; 6(8):613-24. doi:10.1038/nrmicro1932. PMID:18628769

Commichau FM, Stülke J Trigger enzymes: bifunctional proteins active in metabolism and in controlling gene expression. Molecular microbiology. 2008 Feb; 67(4):692-702. . PMID:18086213

Deutscher J, Francke C, Postma PW How phosphotransferase system-related protein phosphorylation regulates carbohydrate metabolism in bacteria. Microbiology and molecular biology reviews : MMBR. 2006 Dec; 70(4):939-1031. . PMID:17158705

Stülke J, Hillen W Regulation of carbon catabolism in Bacillus species. Annual review of microbiology. 2000; 54:849-80. . PMID:11018147

Stülke J, Hillen W Coupling physiology and gene regulation in bacteria: the phosphotransferase sugar uptake system delivers the signals. Die Naturwissenschaften. 1998 Dec; 85(12):583-92. . PMID:9871918

Original Publications

Roth P, Jeckelmann JM, Fender I, Ucurum Z, Lemmin T, Fotiadis DStructure and mechanism of a phosphotransferase system glucose transporter.Nature communications. 2024 Sep 12; 15(1):7992. PMID: 39266522

O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589

Shen J, Liu Z, Yu H, Ye J, Long Y, Zhou P, He B Systematic stress adaptation of Bacillus subtilis to tetracycline exposure. Ecotoxicology and environmental safety. 2019 Nov 15; :109910. pii:S0147-6513(19)31241-2. doi:10.1016/j.ecoenv.2019.109910. PMID:31740237

Morabbi Heravi K, Altenbuchner J Cross-talk among transporters of the phosphoenolpyruvate-dependent phosphotransferase system in . Journal of bacteriology. 2018 Jul 23; . pii:JB.00213-18. doi:10.1128/JB.00213-18. PMID:30038046

McCoy JG, Ren Z, Stanevich V, Lee J, Mitra S, Levin EJ, Poget S, Quick M, Im W, Zhou M The Structure of a Sugar Transporter of the Glucose EIIC Superfamily Provides Insight into the Elevator Mechanism of Membrane Transport. Structure (London, England : 1993). 2016 Jun 07; 24(6):956-64. doi:10.1016/j.str.2016.04.003. pii:S0969-2126(16)30039-9. PMID:27161976

Cabrera-Valladares N, Martínez LM, Flores N, Hernández-Chávez G, Martínez A, Bolívar F, Gosset G Physiologic consequences of glucose transport and phosphoenolpyruvate node modifications in Bacillus subtilis 168. Journal of molecular microbiology and biotechnology. 2012; 22(3):177-97. doi:10.1159/000339973. PMID:22846916

Tojo S, Kumamoto K, Hirooka K, Fujita Y Heavy involvement of stringent transcription control depending on the adenine or guanine species of the transcription initiation site in glucose and pyruvate metabolism in Bacillus subtilis. Journal of bacteriology. 2010 Mar; 192(6):1573-85. doi:10.1128/JB.01394-09. PMID:20081037

Hahne H, Wolff S, Hecker M, Becher D From complementarity to comprehensiveness--targeting the membrane proteome of growing Bacillus subtilis by divergent approaches. Proteomics. 2008 Oct; 8(19):4123-36. doi:10.1002/pmic.200800258. PMID:18763711

Schilling O, Herzberg C, Hertrich T, Vörsmann H, Jessen D, Hübner S, Titgemeyer F, Stülke J Keeping signals straight in transcription regulation: specificity determinants for the interaction of a family of conserved bacterial RNA-protein couples. Nucleic acids research. 2006; 34(21):6102-15. . PMID:17074746

Schilling O, Langbein I, Müller M, Schmalisch MH, Stülke J A protein-dependent riboswitch controlling ptsGHI operon expression in Bacillus subtilis: RNA structure rather than sequence provides interaction specificity. Nucleic acids research. 2004; 32(9):2853-64. . PMID:15155854

Schmalisch MH, Bachem S, Stülke J Control of the Bacillus subtilis antiterminator protein GlcT by phosphorylation. Elucidation of the phosphorylation chain leading to inactivation of GlcT. The Journal of biological chemistry. 2003 Dec 19; 278(51):51108-15. . PMID:14527945

Blencke HM, Homuth G, Ludwig H, Mäder U, Hecker M, Stülke J Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways. Metabolic engineering. 2003 Apr; 5(2):133-49. . PMID:12850135

Stülke J, Martin-Verstraete I, Zagorec M, Rose M, Klier A, Rapoport G Induction of the Bacillus subtilis ptsGHI operon by glucose is controlled by a novel antiterminator, GlcT. Molecular microbiology. 1997 Jul; 25(1):65-78. . PMID:11902727

Reizer J, Bachem S, Reizer A, Arnaud M, Saier MH, Stülke J Novel phosphotransferase system genes revealed by genome analysis - the complete complement of PTS proteins encoded within the genome of Bacillus subtilis. Microbiology (Reading, England). 1999 Dec; 145 ( Pt 12):3419-29. . PMID:10627040

Langbein I, Bachem S, Stülke J Specific interaction of the RNA-binding domain of the bacillus subtilis transcriptional antiterminator GlcT with its RNA target, RAT. Journal of molecular biology. 1999 Nov 05; 293(4):795-805. . PMID:10543968

Bachem S, Stülke J Regulation of the Bacillus subtilis GlcT antiterminator protein by components of the phosphotransferase system. Journal of bacteriology. 1998 Oct; 180(20):5319-26. . PMID:9765562

Chen Y, Case DA, Reizer J, Saier MH, Wright PE High-resolution solution structure of Bacillus subtilis IIAglc. Proteins. 1998 May 15; 31(3):258-70. . PMID:9593197

Bachem S, Faires N, Stülke J Characterization of the presumptive phosphorylation sites of the Bacillus subtilis glucose permease by site-directed mutagenesis: implication in glucose transport and catabolite repression. FEMS microbiology letters. 1997 Nov 15; 156(2):233-8. . PMID:9513271

Chen Y, Reizer J, Saier MH, Fairbrother WJ, Wright PE Mapping of the binding interfaces of the proteins of the bacterial phosphotransferase system, HPr and IIAglc. Biochemistry. 1993 Jan 12; 32(1):32-7. . PMID:8418852

Sutrina SL, Reddy P, Saier MH, Reizer J The glucose permease of Bacillus subtilis is a single polypeptide chain that functions to energize the sucrose permease. The Journal of biological chemistry. 1990 Oct 25; 265(30):18581-9. . PMID:2120236

Gonzy-Tréboul G, de Waard JH, Zagorec M, Postma PW The glucose permease of the phosphotransferase system of Bacillus subtilis: evidence for IIGlc and IIIGlc domains. Molecular microbiology. 1991 May; 5(5):1241-9. . PMID:1956301

Kapadia G, Chen CC, Reddy P, Saier MH, Reizer J, Herzberg O Crystallization of the IIA domain of the glucose permease of Bacillus subtilis. Journal of molecular biology. 1991 Oct 20; 221(4):1079-80. . PMID:1942043

Liao DI, Kapadia G, Reddy P, Saier MH, Reizer J, Herzberg O Structure of the IIA domain of the glucose permease of Bacillus subtilis at 2.2-A resolution. Biochemistry. 1991 Oct 08; 30(40):9583-94. . PMID:1911744

Fairbrother WJ, Cavanagh J, Dyson HJ, Palmer AG, Sutrina SL, Reizer J, Saier MH, Wright PE Polypeptide backbone resonance assignments and secondary structure of Bacillus subtilis enzyme IIIglc determined by two-dimensional and three-dimensional heteronuclear NMR spectroscopy. Biochemistry. 1991 Jul 16; 30(28):6896-907. . PMID:1906345

Fairbrother WJ, Gippert GP, Reizer J, Saier MH, Wright PE Low resolution solution structure of the Bacillus subtilis glucose permease IIA domain derived from heteronuclear three-dimensional NMR spectroscopy. FEBS letters. 1992 Jan 20; 296(2):148-52. . PMID:1733770

Fairbrother WJ, Palmer AG, Rance M, Reizer J, Saier MH, Wright PE Assignment of the aliphatic 1H and 13C resonances of the Bacillus subtilis glucose permease IIA domain using double- and triple-resonance heteronuclear three-dimensional NMR spectroscopy. Biochemistry. 1992 May 12; 31(18):4413-25. . PMID:1581296

Zagorec M, Postma PW Cloning and nucleotide sequence of the ptsG gene of Bacillus subtilis. Molecular & general genetics : MGG. 1992 Aug; 234(2):325-8. . PMID:1508157

Herzberg O An atomic model for protein-protein phosphoryl group transfer. The Journal of biological chemistry. 1992 Dec 05; 267(34):24819-23. . PMID:1447219

Stone MJ, Fairbrother WJ, Palmer AG, Reizer J, Saier MH, Wright PE Backbone dynamics of the Bacillus subtilis glucose permease IIA domain determined from 15N NMR relaxation measurements. Biochemistry. 1992 May 12; 31(18):4394-406. . PMID:1316146

Page visits: 9758

Time of last update: 2025-04-07 10:21:06

Author of last update: Jstuelk

ptsG 168

ptsG
168