gamP

gamP
168

glucosamine-specific permease of the phosphotransferase system, EIICBA of the PTS

Locus
BSU_02350
Molecular weight
67.97 kDa
Isoelectric point
5.47
Protein length
Gene length
Function
glucosamine uptake and phosphorylation
Product
glucosamine-specific PTS, EIICBA
Essential
no
E.C.
2.7.1.69
Synonyms
gamP, ybfS, yzfA

Genomic Context

List of homologs in different organisms, belongs to COG2190 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, GamR regulon

Gene
Coordinates
254,907  256,802
Phenotypes of a mutant
delayed growth with glucosamine as the single carbon source PubMed
The protein
Catalyzed reaction/ biological activity
protein EIIA Npi-phospho-L-histidine + protein EIIB --> protein EIIA + protein EIIB Npi-phospho-L-histidine/cysteine (according to UniProt)
Protein family
PTS permease, glucose family PubMed
PTS EIIA domain type-1 (aa 515-619) (according to UniProt)
PTS EIIB domain type-1 (aa 397-478) (according to UniProt)
PTS EIIC domain type-1 (aa 1-382) (according to UniProt)
Structure
6BVG (PDB) (EIIC domain from B. cereus, corresponds to aa 5 ... 380), 32.5% identity PubMed
3BP3 (PDB) (EIIB domain from E. coli, corresponds to aa 403 ... 467), 56.9% identity PubMed
1AX3 (PDB) (EIIA domain of PtsG, corresponds to aa 489 ... 622), 55.6% identity PubMed
Paralogous protein(s)
membrane PubMed
Expression and Regulation
Operons
Genes
Description
Regulation
induced by glucosamine (GamR) PubMed
Regulatory mechanism
GamR: repression, PubMed, in gamR regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Open in new tab

gamAgamP

2025-04-07 00:18:11

ghost

67

4fffcf05befb972653171bbbe342dd9b2c49f8b3

1347DE6686FBBF7ED2CBD5C47BA6DFFC67338C93

Biological materials
Mutant
MGNA-B937 (ybfS::erm), available at the NBRP B. subtilis, Japan
QB6098 (aphA3), available in Jörg Stülke's lab
BKE02350 (gamP::erm  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CATGACAGTCTCCTTTTATT,  downstream forward: _UP4_TAAAAAAGTCCCCCCTGCTG
BKK02350 (gamP::kan  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CATGACAGTCTCCTTTTATT,  downstream forward: _UP4_TAAAAAAGTCCCCCCTGCTG
References
Reviews
Gilmore MC, Cava FBacterial peptidoglycan recycling.Trends in microbiology. 2024 Nov 28; . PMID: 39613687
Original Publications
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Morabbi Heravi K, Altenbuchner J Cross-talk among transporters of the phosphoenolpyruvate-dependent phosphotransferase system in . Journal of bacteriology. 2018 Jul 23; . pii:JB.00213-18. doi:10.1128/JB.00213-18. PMID:30038046
Ren Z, Lee J, Moosa MM, Nian Y, Hu L, Xu Z, McCoy JG, Ferreon ACM, Im W, Zhou M Structure of an EIIC sugar transporter trapped in an inward-facing conformation. Proceedings of the National Academy of Sciences of the United States of America. 2018 Jun 05; 115(23):5962-5967. doi:10.1073/pnas.1800647115. PMID:29784777
Gaugué I, Oberto J, Putzer H, Plumbridge J The use of amino sugars by Bacillus subtilis: presence of a unique operon for the catabolism of glucosamine. PloS one. 2013; 8(5):e63025. doi:10.1371/journal.pone.0063025. PMID:23667565
Hahne H, Wolff S, Hecker M, Becher D From complementarity to comprehensiveness--targeting the membrane proteome of growing Bacillus subtilis by divergent approaches. Proteomics. 2008 Oct; 8(19):4123-36. doi:10.1002/pmic.200800258. PMID:18763711
Nam TW, Jung HI, An YJ, Park YH, Lee SH, Seok YJ, Cha SS Analyses of Mlc-IIBGlc interaction and a plausible molecular mechanism of Mlc inactivation by membrane sequestration. Proceedings of the National Academy of Sciences of the United States of America. 2008 Mar 11; 105(10):3751-6. doi:10.1073/pnas.0709295105. PMID:18319344
Reizer J, Bachem S, Reizer A, Arnaud M, Saier MH, Stülke J Novel phosphotransferase system genes revealed by genome analysis - the complete complement of PTS proteins encoded within the genome of Bacillus subtilis. Microbiology (Reading, England). 1999 Dec; 145 ( Pt 12):3419-29. . PMID:10627040
Chen Y, Case DA, Reizer J, Saier MH, Wright PE High-resolution solution structure of Bacillus subtilis IIAglc. Proteins. 1998 May 15; 31(3):258-70. . PMID:9593197
Larder BA, Darby G, Richman DDHIV with reduced sensitivity to zidovudine (AZT) isolated during prolonged therapy.Science (New York, N.Y.). 1989 Mar 31; 243(4899):1731-4. PMID: 2467383

4DF1740D4DFB9FD25E77C14D28AEA01707776099

Page visits: 5648

Time of last update: 2025-04-07 06:43:27

Author of last update: Jstuelk