rplK

rplK
168

ribosomal protein uL11, recruitment of RqcH to the 50S subunit of stalled ribosomes

Locus
BSU_01020
Molecular weight
14.78 kDa
Isoelectric point
9.72
Protein length
141 aaSequenceBlast
Gene length
426 bpSequenceBlast
Function
translation
Product
ribosomal protein L11 (uL11)
Essential
no
Synonyms
rplK, relC, tsp
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

List of homologs in different organisms, belongs to COG0080 (Galperin et al., 2021)

This gene is a member of the following regulons

Stringent response

Gene
Coordinates
118,591 → 119,016
Phenotypes of a mutant
poor growth PubMed
non-transformable PubMed
defective in ribosome quality control PubMed
inactivation of rplK confers resistance to thiopeptide antibiotics PubMed
The protein
Catalyzed reaction/ biological activity
recruitment of RqcH to the 50S subunit of stalled ribosomes PubMed
Protein family
Universal ribosomal protein uL11 family (single member, according to UniProt)
Structure
2FOW (PDB) (RNA binding domain in complex with RNA, Geobacillus stearothermophilus) PubMed
1FOX (PDB) (C-terminal domain, Geobacillus stearothermophilus) PubMed
3J9W (PDB) (the ribosome) PubMed
Q06796 (AlphaFold)
Modification
phosphorylated on Arg-94 PubMed
Localization
ribosome (according to UniProt)
Expression and Regulation
Operons
Genes
rplK-rplA-BSU_misc_RNA_3-rplJ-rplL
Description
PubMed
Regulation
Rel dependent downregulation (Class I) during stringent response PubMed
Regulatory mechanism
stringent response: negative regulation, PubMed, in stringent response
Open in new tab

rplK->rplL

2025-03-16 18:19:54

Jstuelk

131

a3b77f9cd37eef4d41bc80e15b9131374c283aa8

9D93F55A2AB271535602470E50EFA15E2E175400

Biological materials
Mutant
BKE01020 (ΔrplK::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACGAGACACACCTCCTTAA,  downstream forward: _UP4_TAATTTGTTTCTTGTCGGGT
BKK01020 (ΔrplK::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACGAGACACACCTCCTTAA,  downstream forward: _UP4_TAATTTGTTTCTTGTCGGGT
References
Woodgate J, Sumang FA, Salliss ME, Belousoff M, Ward AC, Challis GL, Zenkin N, Errington J, Dashti YMode of Action and Mechanisms of Resistance to the Unusual Polyglycosylated Thiopeptide Antibiotic Persiathiacin A.ACS infectious diseases. 2024 Dec 9; . PMID: 39651842
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Takada H, Crowe-McAuliffe C, Polte C, Sidorova ZY, Murina V, Atkinson GC, Konevega AL, Ignatova Z, Wilson DN, Hauryliuk VRqcH and RqcP catalyze processive poly-alanine synthesis in a reconstituted ribosome-associated quality control system.Nucleic acids research. 2021 Jul 13; . PMID: 34255840
Galperin MY, Wolf YI, Garushyants SK, Vera Alvarez R, Koonin EVNon-essential ribosomal proteins in bacteria and archaea identified using COGs.Journal of bacteriology. 2021 Mar 22; . PMID: 33753464
Filbeck S, Cerullo F, Paternoga H, Tsaprailis G, Joazeiro CAP, Pfeffer SMimicry of Canonical Translation Elongation Underlies Alanine Tail Synthesis in RQC.Molecular cell. 2020 Nov 19; . PMID: 33259811
de Jong L, de Koning EA, Roseboom W, Buncherd H, Wanner MJ, Dapic I, Jansen PJ, van Maarseveen JH, Corthals GL, Lewis PJ, Hamoen LW, de Koster CG In-Culture Cross-Linking of Bacterial Cells Reveals Large-Scale Dynamic Protein-Protein Interactions at the Peptide Level. Journal of proteome research. 2017 Jul 07; 16(7):2457-2471. doi:10.1021/acs.jproteome.7b00068. PMID:28516784
Koo BM, Kritikos G, Farelli JD, Todor H, Tong K, Kimsey H, Wapinski I, Galardini M, Cabal A, Peters JM, Hachmann AB, Rudner DZ, Allen KN, Typas A, Gross CA Construction and Analysis of Two Genome-Scale Deletion Libraries for Bacillus subtilis. Cell systems. 2017 Mar 22; 4(3):291-305.e7. pii:S2405-4712(16)30447-1. doi:10.1016/j.cels.2016.12.013. PMID:28189581
Sohmen D, Chiba S, Shimokawa-Chiba N, Innis CA, Berninghausen O, Beckmann R, Ito K, Wilson DN Structure of the Bacillus subtilis 70S ribosome reveals the basis for species-specific stalling. Nature communications. 2015 Apr 23; 6:6941. doi:10.1038/ncomms7941. PMID:25903689
Akanuma G, Nanamiya H, Natori Y, Yano K, Suzuki S, Omata S, Ishizuka M, Sekine Y, Kawamura F Inactivation of ribosomal protein genes in Bacillus subtilis reveals importance of each ribosomal protein for cell proliferation and cell differentiation. Journal of bacteriology. 2012 Nov; 194(22):6282-91. doi:10.1128/JB.01544-12. PMID:23002217
Elsholz AK, Turgay K, Michalik S, Hessling B, Gronau K, Oertel D, Mäder U, Bernhardt J, Becher D, Hecker M, Gerth U Global impact of protein arginine phosphorylation on the physiology of Bacillus subtilis. Proceedings of the National Academy of Sciences of the United States of America. 2012 May 08; 109(19):7451-6. doi:10.1073/pnas.1117483109. PMID:22517742
Irnov I, Sharma CM, Vogel J, Winkler WC Identification of regulatory RNAs in Bacillus subtilis. Nucleic acids research. 2010 Oct; 38(19):6637-51. doi:10.1093/nar/gkq454. PMID:20525796
Baumann S, Schoof S, Bolten M, Haering C, Takagi M, Shin-ya K, Arndt HD Molecular determinants of microbial resistance to thiopeptide antibiotics. Journal of the American Chemical Society. 2010 May 26; 132(20):6973-81. doi:10.1021/ja909317n. PMID:20441189
Lauber MA, Running WE, Reilly JP B. subtilis ribosomal proteins: structural homology and post-translational modifications. Journal of proteome research. 2009 Sep; 8(9):4193-206. doi:10.1021/pr801114k. PMID:19653700
Eymann C, Homuth G, Scharf C, Hecker M Bacillus subtilis functional genomics: global characterization of the stringent response by proteome and transcriptome analysis. Journal of bacteriology. 2002 May; 184(9):2500-20. . PMID:11948165
Zhang S, Scott JM, Haldenwang WG Loss of ribosomal protein L11 blocks stress activation of the Bacillus subtilis transcription factor sigma(B). Journal of bacteriology. 2001 Apr; 183(7):2316-21. . PMID:11244072
Hinck AP, Markus MA, Huang S, Grzesiek S, Kustonovich I, Draper DE, Torchia DAThe RNA binding domain of ribosomal protein L11: three-dimensional structure of the RNA-bound form of the protein and its interaction with 23 S rRNA.Journal of molecular biology. 1997 Nov 21; 274(1):101-13. PMID: 9398519
Markus MA, Hinck AP, Huang S, Draper DE, Torchia DAHigh resolution solution structure of ribosomal protein L11-C76, a helical protein with a flexible loop that becomes structured upon binding to RNA.Nature structural biology. 1997 Jan; 4(1):70-7. PMID: 8989327
Wienen B, Ehrlich R, Stöffler-Meilicke M, Stöffler G, Smith I, Weiss D, Vince R, Pestka S Ribosomal protein alterations in thiostrepton- and Micrococcin-resistant mutants of Bacillus subtilis. The Journal of biological chemistry. 1979 Aug 25; 254(16):8031-41. . PMID:112097

F94A1C14912F35ADB4C611AA17D55268CC26160D

Page visits: 5757

Time of last update: 2025-04-06 13:34:58

Author of last update: Jstuelk