capC

capC
168

part of the CapB-CapC glutamic acid ligase, capsular polyglutamate biosynthesis

Locus
BSU_35890
Molecular weight
16.16 kDa
Isoelectric point
9.67
Protein length
Gene length
Function
capsule synthesis
Product
unknown
Essential
no
Synonyms
capC, ywtA, pgsC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,698,982 → 3,699,431
Phenotypes of a mutant
no synthesis of the poly-gamma-glutamate capsule PubMed
The protein
Expression and Regulation
Operons
Description
Regulatory mechanism
DegU: activation, DegU-P, PubMed, in degU regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Additional information
expression of the operon is increased in 'motA' or 'motB' mutants due to increased DegU phosphorylation PubMed
Open in new tab

capBcapE

2025-03-16 08:50:33

ghost

109

bf6b0bf03353d832d0fb99e09c0c2fcd8af8f057

1302D3190C59C849B9803B3A11C008FA08B67E54

Biological materials
Mutant
MGNA-A076 (ywtA::erm), available at the NBRP B. subtilis, Japan
BKE35890 (ΔcapC::erm  trpC2) available at BGSCPubMed, upstream reverse: _UP1_TCCGAACATGTCTGCATTTC,  downstream forward: _UP4_ATTTAATGTAAGGTGTGTCA
BKK35890 (ΔcapC::kan  trpC2) available at BGSCPubMed, upstream reverse: _UP1_TCCGAACATGTCTGCATTTC,  downstream forward: _UP4_ATTTAATGTAAGGTGTGTCA
References
Reviews
Hsueh YH, Huang KY, Kunene SC, Lee TY Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation. International journal of molecular sciences. 2017 Dec 07; 18(12). pii:E2644. doi:10.3390/ijms18122644. PMID:29215550
Marvasi M, Visscher PT, Casillas Martinez L Exopolymeric substances (EPS) from Bacillus subtilis: polymers and genes encoding their synthesis. FEMS microbiology letters. 2010 Dec; 313(1):1-9. doi:10.1111/j.1574-6968.2010.02085.x. PMID:20735481
Candela T, Fouet A Poly-gamma-glutamate in bacteria. Molecular microbiology. 2006 Jun; 60(5):1091-8. . PMID:16689787
Original Publications
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Liu CL, Dong HG, Xue K, Yang W, Liu P, Cai D, Liu X, Yang Y, Bai Z Biosynthesis of poly-γ-glutamic acid in E. coli by heterologous expression of pgsBCAE operon from Bacillus. Journal of applied microbiology. 2019 Dec 13; . doi:10.1111/jam.14552. PMID:31837088
Tiwari DP, Chatterjee PM, Rotti H, Chand B, Raval R, Dubey AK Expression dynamics of the poly-γ-glutamic acid biosynthesis genes of Bacillus subtilis in response to glucose and glutamic acid-A pilot study. FEMS microbiology letters. 2018 Oct 05; . doi:10.1093/femsle/fny248. PMID:30295732
Sawada K, Araki H, Takimura Y, Masuda K, Kageyama Y, Ozaki K, Hagihara H Poly-L-gamma-glutamic acid production by recombinant Bacillus subtilis without pgsA gene. AMB Express. 2018 Jul 03; 8(1):110. doi:10.1186/s13568-018-0636-x. PMID:29971620
Lin B, Li Z, Zhang H, Wu J, Luo M Cloning and Expression of the γ-Polyglutamic Acid Synthetase Gene pgsBCA in Bacillus subtilis WB600. BioMed research international. 2016; 2016:3073949. doi:10.1155/2016/3073949. PMID:27073802
Chan JM, Guttenplan SB, Kearns DB Defects in the flagellar motor increase synthesis of poly-γ-glutamate in Bacillus subtilis. Journal of bacteriology. 2014 Feb; 196(4):740-53. doi:10.1128/JB.01217-13. PMID:24296669
Do TH, Suzuki Y, Abe N, Kaneko J, Itoh Y, Kimura K Mutations suppressing the loss of DegQ function in Bacillus subtilis (natto) poly-γ-glutamate synthesis. Applied and environmental microbiology. 2011 Dec; 77(23):8249-58. doi:10.1128/AEM.05827-11. PMID:21965392
Kamei T, Yamashiro D, Horiuchii T, Minouchi Y, Ashiuchi M Identification and biochemical characterization of membranous short-chain polyglutamate from Bacillus subtilis. Chemistry & biodiversity. 2010 Jun; 7(6):1563-72. doi:10.1002/cbdv.200900238. PMID:20564574
Yeh CM, Wang JP, Lo SC, Chan WC, Lin MY Chromosomal integration of a synthetic expression control sequence achieves poly-gamma-glutamate production in a Bacillus subtilis strain. Biotechnology progress.; 26(4):1001-7. doi:10.1002/btpr.417. PMID:20564357
Kimura K, Tran LS, Do TH, Itoh Y Expression of the pgsB encoding the poly-gamma-DL-glutamate synthetase of Bacillus subtilis (natto). Bioscience, biotechnology, and biochemistry. 2009 May; 73(5):1149-55. . PMID:19420703
Sung MH, Park C, Kim CJ, Poo H, Soda K, Ashiuchi M Natural and edible biopolymer poly-gamma-glutamic acid: synthesis, production, and applications. Chemical record (New York, N.Y.). 2005; 5(6):352-66. . PMID:16278834
Urushibata Y, Tokuyama S, Tahara Y Difference in transcription levels of cap genes for gamma-polyglutamic acid production between Bacillus subtilis IFO 16449 and Marburg 168. Journal of bioscience and bioengineering. 2002; 93(2):252-4. . PMID:16233197
Urushibata Y, Tokuyama S, Tahara Y Characterization of the Bacillus subtilis ywsC gene, involved in gamma-polyglutamic acid production. Journal of bacteriology. 2002 Jan; 184(2):337-43. . PMID:11751809

D66994D077D1382B88FF65075E44C2A31089548F

Page visits: 4131

Time of last update: 2025-04-07 10:21:01

Author of last update: Jstuelk