skfF

skfF
168

ABC transporter (permease), export of the spore killing factor

Locus
BSU_01960
Molecular weight
51.72 kDa
Isoelectric point
9.22
Protein length
Gene length
Function
export of the spore killing factor SkfA
Product
ABC transporter (permease)
Essential
no
Synonyms
skfF, ybdB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
217,697 → 219,040
Phenotypes of a mutant
inactivation of ''skfF'' reduces sporulation efficiency to 62.3% that of wild type cells PubMed
The protein
Structure
cell membrane (according to UniProt)
Expression and Regulation
Operons
Description
Regulation
expressed under conditions that trigger sporulation (Spo0A) PubMed
Regulatory mechanism
Spo0A: activation, PubMed, in spo0A regulon
AbrB: repression, PubMed, in abrB regulon
PhoP: activation, PubMed, in phoP regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Additional information
Northern blotting during during phosphate limitation showed an intense 0.25 kb 'skfA'-specific transcript, and a weaker 6.5 kb 'skfA-skfB-skfC-skfE-skfF-skfG-skfH' transcript.
Open in new tab

skfAskfH

2025-03-31 01:14:49

ghost

166

f96cb932f6aa46632dc613334e3526e3904b2534

E1A5B1DE7F5A4653FA0FC2E7FE7AAD3454DBFF28

Biological materials
Mutant
MGNA-C516 (ybdB::erm), available at the NBRP B. subtilis, Japan
BKE01960 (ΔskfF::erm  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CATTTTTTTTTCCTGACCTT,  downstream forward: _UP4_TAGTGGTTATGTAGAGTTAT
BKK01960 (ΔskfF::kan  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CATTTTTTTTTCCTGACCTT,  downstream forward: _UP4_TAGTGGTTATGTAGAGTTAT
References
Reviews
González-Pastor JE Cannibalism: a social behavior in sporulating Bacillus subtilis. FEMS microbiology reviews. 2011 May; 35(3):415-24. doi:10.1111/j.1574-6976.2010.00253.x. PMID:20955377
Original Publications
Mahendran A, Orlando BJGenome wide structural prediction of ABC transporter systems in Bacillus subtilis.Frontiers in microbiology. 2024; 15:1469915. PMID: 39397791
Meeske AJ, Rodrigues CD, Brady J, Lim HC, Bernhardt TG, Rudner DZ High-Throughput Genetic Screens Identify a Large and Diverse Collection of New Sporulation Genes in Bacillus subtilis. PLoS biology. 2016 Jan; 14(1):e1002341. doi:10.1371/journal.pbio.1002341. PMID:26735940
Banse AV, Chastanet A, Rahn-Lee L, Hobbs EC, Losick R Parallel pathways of repression and antirepression governing the transition to stationary phase in Bacillus subtilis. Proceedings of the National Academy of Sciences of the United States of America. 2008 Oct 07; 105(40):15547-52. doi:10.1073/pnas.0805203105. PMID:18840696
Strauch MA, Bobay BG, Cavanagh J, Yao F, Wilson A, Le Breton Y Abh and AbrB control of Bacillus subtilis antimicrobial gene expression. Journal of bacteriology. 2007 Nov; 189(21):7720-32. . PMID:17720793
Ochiai A, Itoh T, Kawamata A, Hashimoto W, Murata K Plant cell wall degradation by saprophytic Bacillus subtilis strains: gene clusters responsible for rhamnogalacturonan depolymerization. Applied and environmental microbiology. 2007 Jun; 73(12):3803-13. . PMID:17449691
Allenby NE, Watts CA, Homuth G, Prágai Z, Wipat A, Ward AC, Harwood CR Phosphate starvation induces the sporulation killing factor of Bacillus subtilis. Journal of bacteriology. 2006 Jul; 188(14):5299-303. . PMID:16816204
Fujita M, González-Pastor JE, Losick R High- and low-threshold genes in the Spo0A regulon of Bacillus subtilis. Journal of bacteriology. 2005 Feb; 187(4):1357-68. . PMID:15687200
Fujita M, González-Pastor JE, Losick R High- and low-threshold genes in the Spo0A regulon of Bacillus subtilis. Journal of bacteriology. 2005 Feb; 187(4):1357-68. . PMID:15687200
Molle V, Fujita M, Jensen ST, Eichenberger P, González-Pastor JE, Liu JS, Losick R The Spo0A regulon of Bacillus subtilis. Molecular microbiology. 2003 Dec; 50(5):1683-701. . PMID:14651647
González-Pastor JE, Hobbs EC, Losick R Cannibalism by sporulating bacteria. Science (New York, N.Y.). 2003 Jul 25; 301(5632):510-3. . PMID:12817086
Isezaki M, Hosoya S, Takeuchi M, Sato T A putative ATP-binding cassette transporter YbdA involved in sporulation of Bacillus subtilis. FEMS microbiology letters. 2001 Nov 13; 204(2):239-45. . PMID:11731129
Quentin Y, Fichant G, Denizot F Inventory, assembly and analysis of Bacillus subtilis ABC transport systems. Journal of molecular biology. 1999 Apr 02; 287(3):467-84. . PMID:10092453

77D93CAEF46EBBB9BAF570714445E194D5F2884E

Page visits: 4648

Time of last update: 2025-04-07 04:47:07

Author of last update: Jstuelk