GTPase, nucleotide-binding protein, similar to RNase adaptor protein
function
required for the expression of late competence genes
Genomic Context
categories
[category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence][category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]Gene
Coordinates
3,571,501 → 3,572,388
Phenotypes of a mutant
reduced [SW|genetic competence] [Pubmed|19074378]The protein
Catalyzed reaction/ biological activity
binds and hydrolyzes nucleotides, required for the expression of late competence genes (''[gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK], [gene|4D76F07D6124D56C7CEBBDAB9E84B2718BF1E7FC|comS]'') [Pubmed|19074378]Protein family
UPF0042 family (according to Swiss-Prot)Structure
[PDB|5O5Q] (RapZ from E. coli, 41% identity) [pubmed|28977623][SW|Localization]
can be localized in the cell either as a helical-like pattern or as foci close to the poles and the septa depending on growth phase and on growth medium [Pubmed|21709426]Additional information
[http://www.ncbi.nlm.nih.gov/sites/entrez?Db=gene&Cmd=retrieve&dopt=full_report&list_uids=947727&log$=genesensor5&logdbfrom=pubmed Information on the ''E. coli'' homolog]Expression and Regulation
Operons
genes
[gene|0C40455EB53D25363FC3EB0E84502A76520F5F91|nahA]-[gene|EB12C6B4F36B57BF0C59CE048CBAE18734C78D35|yvcJ]-[gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR]-[gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA]-[gene|A269774F2FDC94F93BA5F1360FFFE754B50383AD|crh]-[gene|C521BEE1EEEA7AD283A3C47C34301A8603CD9188|yvcN]
description
[Pubmed|9237995]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16272399], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]regulation
constitutive expression at both protein and RNA levels [Pubmed|24097947,22383849]additional information
A [protein|search|ncRNA] is predicted between '[protein|search|yvcI]' and '[protein|search|trxB]' [PubMed|20525796]view in new tabBiological materials
Mutant
MGNA-B641 (yvcJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1640 NBRP B. subtilis, Japan]1A885 ( ''yvcJ''::''cat''), [Pubmed|19074378], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A885&Search=1A885 BGSC]BKE34770 (Δ[gene|EB12C6B4F36B57BF0C59CE048CBAE18734C78D35|yvcJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTCTCCCCCCTGACT, downstream forward: _UP4_ATTGAAAAGAGAAGCCGGAABKK34770 (Δ[gene|EB12C6B4F36B57BF0C59CE048CBAE18734C78D35|yvcJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTCTCCCCCCTGACT, downstream forward: _UP4_ATTGAAAAGAGAAGCCGGAAExpression vector
pGP735 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Stülke] labtwo-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW| Görke] labLabs working on this gene/protein
[SW|Anne Galinier], University of Marseille, FranceReferences
Original publications
9237995,16272399,19074378,21709426 Publications on the ''E. coli'' homolog
17824929,28977623,24667238,23475961