phosphofructokinase, glycolytic enzyme
function
catabolic enzyme in glycolysis
product
6-phosphofructokinase
Genomic Context
categories
[category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.1|Glycolysis][category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes][category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]Gene
Coordinates
2,986,588 2,987,547
Phenotypes of a mutant
essential according to [Pubmed|12682299], non-essential according to [Pubmed|23420519,20473954]poor growth [pubmed|28189581]poorly transformable [pubmed|28189581]The protein
Catalyzed reaction/ biological activity
ATP + β-D-fructose 6-phosphate --> ADP + β-D-fructose 1,6-bisphosphate + H+ (according to UniProt)Protein family
phosphofructokinase type A (PFKA) family (single member, according to UniProt)Kinetic information
Allosteric Regulation (Reversible) [Pubmed|4269800][SW|Domains]
3 x nucleotide binding domain (ATP) (2125), (154158), (171187)Modification
phosphorylated on Arg-233 [Pubmed|22517742][SW|Cofactors]
Mg2+Effectors of protein activity
Inhibited by citrate, PEP (Hill Coefficient 3) and Ca2+ (competes with Mg2+) in ''B. licheniformes'' [Pubmed|4269800].Inhibited by ATP (competitively) and f6p (non-competitively) in ''G. stearothermophillus'' [Pubmed|8136379]Activated by GDP and ADP in lower concentrations (1mM); above that inhibition, competing with the ATP for the binding site (in ''G. stearothermophillus'') [Pubmed|7873536]Activated by NH4+ [Pubmed|7873536]Structure
[PDB|4A3S] [Pubmed|22198292][PDB|1MTO] (mutant, complex with fructose-6-phosphate, ''Geobacillus stearothermophilus'')[PDB|4PFK] (''Geobacillus stearothermophilus'')[SW|Localization]
cytoplasm (homogeneous) [Pubmed|29439991,16479537,27708634]Additional information
PfkA is a [SW|moonlighting proteins|moonlighting protein] [Pubmed|19193632]extensive information on the structure and enzymatic properties of PfkA can be found at [http://www.proteopedia.org/wiki/index.php/Phosphofructokinase_(PFK) Proteopedia]Expression and Regulation
Operons
genes
[gene|A7E31A5EBCF343B3A841E5F6E9CDE3CA5D1622EB|pfkA]-[gene|F76A03A71DADC32C7166E37B994EFED019FDF8A4|pyk]-[gene|1C6D935B36416327FE63CABC53440441E8563D7E|ytzA]
description
[Pubmed|11489127]
regulation
twofold induced by glucose [Pubmed|11489127]view in new tabBiological materials
Mutant
GP590 ([gene|A7E31A5EBCF343B3A841E5F6E9CDE3CA5D1622EB|pfkA]::''cat''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]GP595 ([gene|A7E31A5EBCF343B3A841E5F6E9CDE3CA5D1622EB|pfkA]::''erm''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]GP1744: BSB1 [gene|A7E31A5EBCF343B3A841E5F6E9CDE3CA5D1622EB|pfkA]::''aphA3'', available in [SW|Jörg Stülke]' labGP1747: [gene|A7E31A5EBCF343B3A841E5F6E9CDE3CA5D1622EB|pfkA]::''aphA3'', available in [SW|Jörg Stülke]' lab, [Pubmed|27708634]BKE29190 ([gene|A7E31A5EBCF343B3A841E5F6E9CDE3CA5D1622EB|pfkA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCATTCACCTCAGC, downstream forward: _UP4_TAATGTACAGCTGAAGGCTGBKK29190 ([gene|A7E31A5EBCF343B3A841E5F6E9CDE3CA5D1622EB|pfkA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCATTCACCTCAGC, downstream forward: _UP4_TAATGTACAGCTGAAGGCTGExpression vectors
for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], in [SW|pGP380]: pGP87, available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], in [SW|pGP382]: pGP1266, available in [SW|Jörg Stülke]'s labfor expression/ purification from ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP393, available in [SW|Jörg Stülke]'s labfor expression in ''B. subtilis'', in [SW|pBQ200]: pGP1422, available in [SW|Jörg Stülke]'s lablacZ fusion
pGP511 (in [protein|search|pAC6]), available in [SW|Jörg Stülke]'s labGFP fusion
GP1720 (in [SW|pBP43]), expression of '' pfkA-GFP''::''spc'' under the native promoter, available in [SW|Jörg Stülke]'s lab [Pubmed|27708634]two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]FLAG-tag construct
GP1019 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lablabs
[SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]References
29439991,16479537,19193632,11489127,8136379,7873536,4269800,20473954,20572937,21803996,22198292,22198292,22517742,23420519,27708634,28189581