Catalyzed reaction/ biological activity
formate + NAD+ --> CO2 + NADH (according to UniProt)Protein family
C-terminal part: [SW|prokaryotic molybdopterin-containing oxidoreductase family] (according to UniProt)Paralogous protein(s)
[protein|E54F39E72DC4881E886159607C2B424A41DE0D01|YjgC] [SW|Domains]
2Fe-2S ferredoxin-type domain (aa 5-81) (according to UniProt)4Fe-4S His(Cys)3-ligated-type domain (aa 81-121) (according to UniProt)2 [SW|4Fe-4S ferredoxin-type domain]s (aa 144-171, aa 187-216) (according to UniProt)[SW|4Fe-4S Mo/W bis-MGD-type domain] (aa 263-319) (according to UniProt)Modification
Fe-S cluster [pubmed|29292548][SW|Cofactors]
contains an iron-sulfur clusterStructure
[PDB|2FUG] (from Thermus thermophilus, 23% identity) [pubmed|16469879]Additional information
The gene is annotated in KEGG as an ortholog of formate dehydrogenase EC 1.2.1.2. In Swiss-Prot the protein is named formate dehydrogenase chain A. In MetaCyc the protein is characterized as similar to formate dehydrogenase. No literature/experimental evidence supporting the annotation is available. [Pubmed|19935659]Mutant
MGNA-A160 (yrhE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/160 NBRP B. subtilis, Japan]BKE27220 ([gene|A4304213CFC152B601B2EED2B9B3A0A3AB4E6A81|yrhE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCATATTCCCCTCCA, downstream forward: _UP4_GATTAAACGATAGGAGGAAABKK27220 ([gene|A4304213CFC152B601B2EED2B9B3A0A3AB4E6A81|yrhE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCATATTCCCCTCCA, downstream forward: _UP4_GATTAAACGATAGGAGGAAA