Mutant
MGNA-A773 (ykuL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/773 NBRP B. subtilis, Japan]BKE14130 (''ykuL''::''erm trpC2'') available in the Bacillus Genetic Stock Center and in [SW|Jrg Stlke]'s lab [pubmed|28189581]GP214 (deletion of ''[gene|A26502ADAC214D45A8F7F394587B0BDFBE7AF28E|ykuJ]-[gene|7FD784C885605F7FD27898BC9E83C28F21BE0E9D|ykuK]-[gene|899FF5BEE5D3F01778A0175E293EDBBDEB25717D|abbA]-[gene|90AFF93D6E7BC993B2773C12EE400C80A87A4831|darB]'', replaced by ''aphA3''), available in the [SW|Stlke] labBKE14130 ([gene|90AFF93D6E7BC993B2773C12EE400C80A87A4831|darB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCGACCCCTTTTC, downstream forward: _UP4_TAGGCTGTACGGTCCTATTTBKK14130 ([gene|90AFF93D6E7BC993B2773C12EE400C80A87A4831|darB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCGACCCCTTTTC, downstream forward: _UP4_TAGGCTGTACGGTCCTATTTExpression vectors
pGP2929 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jrg Stlke]'s labpGP635: expression of Strep-''ykuL'' by [SW|pGP380] in ''B. subtilis'' suitable for [SW|SPINE], available in [SW|Jrg Stlke]'s labpGP767: expression of ''ykuL''-Strep by [SW|pGP382] in ''B. subtilis'' suitable for [SW|SPINE], available in [SW|Jrg Stlke]'s labpGP1550: expression of ''ykuL'' by [SW|pBQ200] in ''B. subtilis'', available in [SW|Jrg Stlke]'s labtwo-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jrg Stlke]'s labFLAG-tag construct
GP2810 ''ykuL-3xFLAG spc'' (based on [SW|pGP1331]), available in [SW|Jrg Stlke]'s lab