You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
yocM [2019-09-04 10:51:37]
small heat-shock protein, protects cell during salt stress
Genomic Context
categories
[category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]Gene
Coordinates
2,098,316 2,098,792
Phenotypes of a mutant
impaired survival after salt shock [pubmed|30431188]The protein
Protein family
[SW|small heat shock protein (Hsp20) family] (according to UniProt)Biological materials
Mutant
MGNA-B417 (yocM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1416 NBRP B. subtilis, Japan]BKE19260 ([gene|1FC88F6350BC721F0C554E878366B1BC171613E3|yocM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAAGCCCCCTGTCTT, downstream forward: _UP4_GACGAAGGTCAAGCGAAAACBKK19260 ([gene|1FC88F6350BC721F0C554E878366B1BC171613E3|yocM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAAGCCCCCTGTCTT, downstream forward: _UP4_GACGAAGGTCAAGCGAAAACReferences